I: pbuilder: network access will be disabled during build I: Current time: Thu Jul 3 19:59:13 +14 2025 I: pbuilder-time-stamp: 1751522353 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/unstable-reproducible-base.tgz] I: copying local configuration W: --override-config is not set; not updating apt.conf Read the manpage for details. I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [bio-tradis_1.4.5+dfsg2-2.dsc] I: copying [./bio-tradis_1.4.5+dfsg2.orig.tar.xz] I: copying [./bio-tradis_1.4.5+dfsg2-2.debian.tar.xz] I: Extracting source gpgv: Signature made Thu Jan 25 14:37:55 2024 gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: cannot verify inline signature for ./bio-tradis_1.4.5+dfsg2-2.dsc: no acceptable signature found dpkg-source: info: extracting bio-tradis in bio-tradis-1.4.5+dfsg2 dpkg-source: info: unpacking bio-tradis_1.4.5+dfsg2.orig.tar.xz dpkg-source: info: unpacking bio-tradis_1.4.5+dfsg2-2.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying samtools1.10 I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/952969/tmp/hooks/D01_modify_environment starting debug: Running on ionos5-amd64. I: Changing host+domainname to test build reproducibility I: Adding a custom variable just for the fun of it... I: Changing /bin/sh to bash '/bin/sh' -> '/bin/bash' lrwxrwxrwx 1 root root 9 Jul 3 05:59 /bin/sh -> /bin/bash I: Setting pbuilder2's login shell to /bin/bash I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other I: user script /srv/workspace/pbuilder/952969/tmp/hooks/D01_modify_environment finished I: user script /srv/workspace/pbuilder/952969/tmp/hooks/D02_print_environment starting I: set BASH=/bin/sh BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:globskipdots:hostcomplete:interactive_comments:patsub_replacement:progcomp:promptvars:sourcepath BASH_ALIASES=() BASH_ARGC=() BASH_ARGV=() BASH_CMDS=() BASH_LINENO=([0]="12" [1]="0") BASH_LOADABLES_PATH=/usr/local/lib/bash:/usr/lib/bash:/opt/local/lib/bash:/usr/pkg/lib/bash:/opt/pkg/lib/bash:. BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment") BASH_VERSINFO=([0]="5" [1]="2" [2]="21" [3]="1" [4]="release" [5]="x86_64-pc-linux-gnu") BASH_VERSION='5.2.21(1)-release' BUILDDIR=/build/reproducible-path BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other' BUILDUSERNAME=pbuilder2 BUILD_ARCH=amd64 DEBIAN_FRONTEND=noninteractive DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=42 ' DIRSTACK=() DISTRIBUTION=unstable EUID=0 FUNCNAME=([0]="Echo" [1]="main") GROUPS=() HOME=/root HOSTNAME=i-capture-the-hostname HOSTTYPE=x86_64 HOST_ARCH=amd64 IFS=' ' INVOCATION_ID=05bcef2a5bd3463ebf93e170d521761c LANG=C LANGUAGE=et_EE:et LC_ALL=C MACHTYPE=x86_64-pc-linux-gnu MAIL=/var/mail/root OPTERR=1 OPTIND=1 OSTYPE=linux-gnu PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path PBCURRENTCOMMANDLINEOPERATION=build PBUILDER_OPERATION=build PBUILDER_PKGDATADIR=/usr/share/pbuilder PBUILDER_PKGLIBDIR=/usr/lib/pbuilder PBUILDER_SYSCONFDIR=/etc PIPESTATUS=([0]="0") POSIXLY_CORRECT=y PPID=952969 PS4='+ ' PWD=/ SHELL=/bin/bash SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix SHLVL=3 SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.aj2kdRwM/pbuilderrc_upP1 --distribution unstable --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/unstable-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.aj2kdRwM/b2 --logfile b2/build.log bio-tradis_1.4.5+dfsg2-2.dsc' SUDO_GID=110 SUDO_UID=105 SUDO_USER=jenkins TERM=unknown TZ=/usr/share/zoneinfo/Etc/GMT-14 UID=0 USER=root _='I: set' http_proxy=http://213.165.73.152:3128 I: uname -a Linux i-capture-the-hostname 6.7.12+bpo-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.7.12-1~bpo12+1 (2024-05-06) x86_64 GNU/Linux I: ls -l /bin lrwxrwxrwx 1 root root 7 Jun 29 14:05 /bin -> usr/bin I: user script /srv/workspace/pbuilder/952969/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: amd64 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), libbio-perl-perl, libenv-path-perl, libexception-class-perl, libmoose-perl, libtest-exception-perl, libtest-files-perl, libtest-most-perl, libtest-simple-perl, libtext-csv-perl, libtry-tiny-perl, perl, samtools, smalt, tabix, bwa dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19716 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on libbio-perl-perl; however: Package libbio-perl-perl is not installed. pbuilder-satisfydepends-dummy depends on libenv-path-perl; however: Package libenv-path-perl is not installed. pbuilder-satisfydepends-dummy depends on libexception-class-perl; however: Package libexception-class-perl is not installed. pbuilder-satisfydepends-dummy depends on libmoose-perl; however: Package libmoose-perl is not installed. pbuilder-satisfydepends-dummy depends on libtest-exception-perl; however: Package libtest-exception-perl is not installed. pbuilder-satisfydepends-dummy depends on libtest-files-perl; however: Package libtest-files-perl is not installed. pbuilder-satisfydepends-dummy depends on libtest-most-perl; however: Package libtest-most-perl is not installed. pbuilder-satisfydepends-dummy depends on libtext-csv-perl; however: Package libtext-csv-perl is not installed. pbuilder-satisfydepends-dummy depends on libtry-tiny-perl; however: Package libtry-tiny-perl is not installed. pbuilder-satisfydepends-dummy depends on samtools; however: Package samtools is not installed. pbuilder-satisfydepends-dummy depends on smalt; however: Package smalt is not installed. pbuilder-satisfydepends-dummy depends on tabix; however: Package tabix is not installed. pbuilder-satisfydepends-dummy depends on bwa; however: Package bwa is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bsdextrautils{a} bwa{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} gettext{a} gettext-base{a} groff-base{a} intltool-debian{a} libalgorithm-c3-perl{a} libalgorithm-diff-perl{a} libarchive-zip-perl{a} libb-hooks-op-check-perl{a} libbambamc0{a} libbio-perl-perl{a} libbrotli1{a} libcapture-tiny-perl{a} libclass-c3-perl{a} libclass-data-inheritable-perl{a} libclass-load-perl{a} libclass-load-xs-perl{a} libclass-xsaccessor-perl{a} libclone-perl{a} libcom-err2{a} libconst-fast-perl{a} libcurl3t64-gnutls{a} libdata-compare-perl{a} libdata-optlist-perl{a} libdata-stag-perl{a} libdebhelper-perl{a} libdeflate0{a} libdevel-callchecker-perl{a} libdevel-globaldestruction-perl{a} libdevel-overloadinfo-perl{a} libdevel-stacktrace-perl{a} libdist-checkconflicts-perl{a} libdynaloader-functions-perl{a} libelf1t64{a} libenv-path-perl{a} libeval-closure-perl{a} libexception-class-perl{a} libfile-chdir-perl{a} libfile-find-rule-perl{a} libfile-stripnondeterminism-perl{a} libgssapi-krb5-2{a} libhts3t64{a} libhtscodecs2{a} libicu72{a} libio-string-perl{a} libk5crypto3{a} libkeyutils1{a} libkrb5-3{a} libkrb5support0{a} libldap-2.5-0{a} libmagic-mgc{a} libmagic1t64{a} libmodule-implementation-perl{a} libmodule-runtime-conflicts-perl{a} libmodule-runtime-perl{a} libmoose-perl{a} libmro-compat-perl{a} libncurses6{a} libnghttp2-14{a} libnumber-compare-perl{a} libpackage-deprecationmanager-perl{a} libpackage-stash-perl{a} libpackage-stash-xs-perl{a} libpadwalker-perl{a} libparams-classify-perl{a} libparams-util-perl{a} libpath-tiny-perl{a} libpipeline1{a} libpsl5t64{a} librtmp1{a} libsasl2-2{a} libsasl2-modules-db{a} libssh2-1t64{a} libsub-exporter-perl{a} libsub-exporter-progressive-perl{a} libsub-install-perl{a} libsub-uplevel-perl{a} libterm-table-perl{a} libtest-deep-perl{a} libtest-differences-perl{a} libtest-exception-perl{a} libtest-files-perl{a} libtest-most-perl{a} libtest-warn-perl{a} libtest2-suite-perl{a} libtext-csv-perl{a} libtext-diff-perl{a} libtext-glob-perl{a} libtool{a} libtry-tiny-perl{a} libuchardet0{a} libxml2{a} m4{a} man-db{a} po-debconf{a} samtools{a} sensible-utils{a} smalt{a} tabix{a} The following packages are RECOMMENDED but will NOT be installed: bioperl-run ca-certificates curl krb5-locales libace-perl libalgorithm-diff-xs-perl libalgorithm-munkres-perl libarchive-cpio-perl libarray-compare-perl libbio-asn1-entrezgene-perl libbio-perl-run-perl libclass-c3-xs-perl libconvert-binary-c-perl libdbd-mysql-perl libdbd-pg-perl libdbd-sqlite3-perl libdevel-lexalias-perl libdevel-partialdump-perl libgd-perl libgpm2 libgraph-perl libgraphviz-perl libhtml-parser-perl libhtml-tableextract-perl libldap-common liblist-moreutils-perl libltdl-dev libmail-sendmail-perl libmldbm-perl libmodule-pluggable-perl libpostscript-perl libsasl2-modules libset-scalar-perl libsoap-lite-perl libsort-naturally-perl libspreadsheet-parseexcel-perl libspreadsheet-writeexcel-perl libsvg-graph-perl libsvg-perl libtext-csv-xs-perl libunicode-linebreak-perl libunicode-utf8-perl liburi-perl libwww-perl libxml-dom-xpath-perl libxml-libxml-perl libxml-libxslt-perl libxml-parser-perl libxml-perl libxml-sax-perl libxml-sax-writer-perl libxml-simple-perl libxml-twig-perl libxml-writer-perl lynx perl-tk publicsuffix wget 0 packages upgraded, 109 newly installed, 0 to remove and 0 not upgraded. Need to get 28.5 MB of archives. After unpacking 102 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian unstable/main amd64 sensible-utils all 0.0.22 [22.4 kB] Get: 2 http://deb.debian.org/debian unstable/main amd64 libmagic-mgc amd64 1:5.45-3 [314 kB] Get: 3 http://deb.debian.org/debian unstable/main amd64 libmagic1t64 amd64 1:5.45-3 [105 kB] Get: 4 http://deb.debian.org/debian unstable/main amd64 file amd64 1:5.45-3 [42.9 kB] Get: 5 http://deb.debian.org/debian unstable/main amd64 gettext-base amd64 0.21-14+b1 [161 kB] Get: 6 http://deb.debian.org/debian unstable/main amd64 libuchardet0 amd64 0.0.8-1+b1 [68.8 kB] Get: 7 http://deb.debian.org/debian unstable/main amd64 groff-base amd64 1.23.0-4 [1180 kB] Get: 8 http://deb.debian.org/debian unstable/main amd64 bsdextrautils amd64 2.40.1-4 [95.7 kB] Get: 9 http://deb.debian.org/debian unstable/main amd64 libpipeline1 amd64 1.5.7-2 [38.0 kB] Get: 10 http://deb.debian.org/debian unstable/main amd64 man-db amd64 2.12.1-1 [1411 kB] Get: 11 http://deb.debian.org/debian unstable/main amd64 m4 amd64 1.4.19-4 [287 kB] Get: 12 http://deb.debian.org/debian unstable/main amd64 autoconf all 2.71-3 [332 kB] Get: 13 http://deb.debian.org/debian unstable/main amd64 autotools-dev all 20220109.1 [51.6 kB] Get: 14 http://deb.debian.org/debian unstable/main amd64 automake all 1:1.16.5-1.3 [823 kB] Get: 15 http://deb.debian.org/debian unstable/main amd64 autopoint all 0.21-14 [496 kB] Get: 16 http://deb.debian.org/debian unstable/main amd64 bwa amd64 0.7.17-7+b3 [212 kB] Get: 17 http://deb.debian.org/debian unstable/main amd64 libdebhelper-perl all 13.15.3 [88.0 kB] Get: 18 http://deb.debian.org/debian unstable/main amd64 libtool all 2.4.7-7 [517 kB] Get: 19 http://deb.debian.org/debian unstable/main amd64 dh-autoreconf all 20 [17.1 kB] Get: 20 http://deb.debian.org/debian unstable/main amd64 libarchive-zip-perl all 1.68-1 [104 kB] Get: 21 http://deb.debian.org/debian unstable/main amd64 libfile-stripnondeterminism-perl all 1.14.0-1 [19.5 kB] Get: 22 http://deb.debian.org/debian unstable/main amd64 dh-strip-nondeterminism all 1.14.0-1 [8448 B] Get: 23 http://deb.debian.org/debian unstable/main amd64 libelf1t64 amd64 0.191-1+b1 [189 kB] Get: 24 http://deb.debian.org/debian unstable/main amd64 dwz amd64 0.15-1+b1 [110 kB] Get: 25 http://deb.debian.org/debian unstable/main amd64 libicu72 amd64 72.1-4+b1 [9395 kB] Get: 26 http://deb.debian.org/debian unstable/main amd64 libxml2 amd64 2.12.7+dfsg-2 [670 kB] Get: 27 http://deb.debian.org/debian unstable/main amd64 gettext amd64 0.21-14+b1 [1301 kB] Get: 28 http://deb.debian.org/debian unstable/main amd64 intltool-debian all 0.35.0+20060710.6 [22.9 kB] Get: 29 http://deb.debian.org/debian unstable/main amd64 po-debconf all 1.0.21+nmu1 [248 kB] Get: 30 http://deb.debian.org/debian unstable/main amd64 debhelper all 13.15.3 [901 kB] Get: 31 http://deb.debian.org/debian unstable/main amd64 libalgorithm-c3-perl all 0.11-2 [10.8 kB] Get: 32 http://deb.debian.org/debian unstable/main amd64 libalgorithm-diff-perl all 1.201-1 [43.3 kB] Get: 33 http://deb.debian.org/debian unstable/main amd64 libb-hooks-op-check-perl amd64 0.22-3+b1 [10.6 kB] Get: 34 http://deb.debian.org/debian unstable/main amd64 libbambamc0 amd64 0.0.50-6+b1 [39.1 kB] Get: 35 http://deb.debian.org/debian unstable/main amd64 libio-string-perl all 1.08-4 [12.1 kB] Get: 36 http://deb.debian.org/debian unstable/main amd64 libdata-stag-perl all 0.14-3 [448 kB] Get: 37 http://deb.debian.org/debian unstable/main amd64 libbio-perl-perl all 1.7.8-1 [2603 kB] Get: 38 http://deb.debian.org/debian unstable/main amd64 libbrotli1 amd64 1.1.0-2+b3 [305 kB] Get: 39 http://deb.debian.org/debian unstable/main amd64 libcapture-tiny-perl all 0.48-2 [24.6 kB] Get: 40 http://deb.debian.org/debian unstable/main amd64 libclass-c3-perl all 0.35-2 [21.0 kB] Get: 41 http://deb.debian.org/debian unstable/main amd64 libclass-data-inheritable-perl all 0.08-3 [8588 B] Get: 42 http://deb.debian.org/debian unstable/main amd64 libparams-util-perl amd64 1.102-3 [24.0 kB] Get: 43 http://deb.debian.org/debian unstable/main amd64 libsub-install-perl all 0.929-1 [10.5 kB] Get: 44 http://deb.debian.org/debian unstable/main amd64 libdata-optlist-perl all 0.114-1 [10.6 kB] Get: 45 http://deb.debian.org/debian unstable/main amd64 libdynaloader-functions-perl all 0.003-3 [12.7 kB] Get: 46 http://deb.debian.org/debian unstable/main amd64 libdevel-callchecker-perl amd64 0.009-1 [15.9 kB] Get: 47 http://deb.debian.org/debian unstable/main amd64 libparams-classify-perl amd64 0.015-2+b3 [22.4 kB] Get: 48 http://deb.debian.org/debian unstable/main amd64 libmodule-runtime-perl all 0.016-2 [19.6 kB] Get: 49 http://deb.debian.org/debian unstable/main amd64 libtry-tiny-perl all 0.31-2 [22.6 kB] Get: 50 http://deb.debian.org/debian unstable/main amd64 libmodule-implementation-perl all 0.09-2 [12.6 kB] Get: 51 http://deb.debian.org/debian unstable/main amd64 libpackage-stash-perl all 0.40-1 [22.0 kB] Get: 52 http://deb.debian.org/debian unstable/main amd64 libclass-load-perl all 0.25-2 [15.3 kB] Get: 53 http://deb.debian.org/debian unstable/main amd64 libclass-load-xs-perl amd64 0.10-2+b3 [14.1 kB] Get: 54 http://deb.debian.org/debian unstable/main amd64 libclass-xsaccessor-perl amd64 1.19-4+b3 [36.2 kB] Get: 55 http://deb.debian.org/debian unstable/main amd64 libclone-perl amd64 0.46-1+b2 [13.7 kB] Get: 56 http://deb.debian.org/debian unstable/main amd64 libcom-err2 amd64 1.47.1-1 [22.9 kB] Get: 57 http://deb.debian.org/debian unstable/main amd64 libsub-exporter-perl all 0.990-1 [50.6 kB] Get: 58 http://deb.debian.org/debian unstable/main amd64 libsub-exporter-progressive-perl all 0.001013-3 [7496 B] Get: 59 http://deb.debian.org/debian unstable/main amd64 libconst-fast-perl all 0.014-2 [8792 B] Get: 60 http://deb.debian.org/debian unstable/main amd64 libkrb5support0 amd64 1.20.1-6+b1 [33.3 kB] Get: 61 http://deb.debian.org/debian unstable/main amd64 libk5crypto3 amd64 1.20.1-6+b1 [79.8 kB] Get: 62 http://deb.debian.org/debian unstable/main amd64 libkeyutils1 amd64 1.6.3-3 [8952 B] Get: 63 http://deb.debian.org/debian unstable/main amd64 libkrb5-3 amd64 1.20.1-6+b1 [333 kB] Get: 64 http://deb.debian.org/debian unstable/main amd64 libgssapi-krb5-2 amd64 1.20.1-6+b1 [135 kB] Get: 65 http://deb.debian.org/debian unstable/main amd64 libsasl2-modules-db amd64 2.1.28+dfsg1-6 [19.5 kB] Get: 66 http://deb.debian.org/debian unstable/main amd64 libsasl2-2 amd64 2.1.28+dfsg1-6 [56.9 kB] Get: 67 http://deb.debian.org/debian unstable/main amd64 libldap-2.5-0 amd64 2.5.17+dfsg-1 [186 kB] Get: 68 http://deb.debian.org/debian unstable/main amd64 libnghttp2-14 amd64 1.61.0-1+b1 [75.6 kB] Get: 69 http://deb.debian.org/debian unstable/main amd64 libpsl5t64 amd64 0.21.2-1.1 [56.8 kB] Get: 70 http://deb.debian.org/debian unstable/main amd64 librtmp1 amd64 2.4+20151223.gitfa8646d.1-2+b4 [58.5 kB] Get: 71 http://deb.debian.org/debian unstable/main amd64 libssh2-1t64 amd64 1.11.0-5 [215 kB] Get: 72 http://deb.debian.org/debian unstable/main amd64 libcurl3t64-gnutls amd64 8.8.0-1 [434 kB] Get: 73 http://deb.debian.org/debian unstable/main amd64 libnumber-compare-perl all 0.03-3 [6332 B] Get: 74 http://deb.debian.org/debian unstable/main amd64 libtext-glob-perl all 0.11-3 [7676 B] Get: 75 http://deb.debian.org/debian unstable/main amd64 libfile-find-rule-perl all 0.34-3 [26.6 kB] Get: 76 http://deb.debian.org/debian unstable/main amd64 libdata-compare-perl all 1.29-1 [19.6 kB] Get: 77 http://deb.debian.org/debian unstable/main amd64 libdeflate0 amd64 1.20-1 [46.0 kB] Get: 78 http://deb.debian.org/debian unstable/main amd64 libdevel-globaldestruction-perl all 0.14-4 [7144 B] Get: 79 http://deb.debian.org/debian unstable/main amd64 libmro-compat-perl all 0.15-2 [11.8 kB] Get: 80 http://deb.debian.org/debian unstable/main amd64 libdevel-overloadinfo-perl all 0.007-1 [7896 B] Get: 81 http://deb.debian.org/debian unstable/main amd64 libdevel-stacktrace-perl all 2.0500-1 [26.4 kB] Get: 82 http://deb.debian.org/debian unstable/main amd64 libdist-checkconflicts-perl all 0.11-2 [10.5 kB] Get: 83 http://deb.debian.org/debian unstable/main amd64 libenv-path-perl all 0.19-4 [19.1 kB] Get: 84 http://deb.debian.org/debian unstable/main amd64 libeval-closure-perl all 0.14-3 [11.2 kB] Get: 85 http://deb.debian.org/debian unstable/main amd64 libexception-class-perl all 1.45-1 [34.6 kB] Get: 86 http://deb.debian.org/debian unstable/main amd64 libfile-chdir-perl all 0.1008-1.2 [11.9 kB] Get: 87 http://deb.debian.org/debian unstable/main amd64 libhtscodecs2 amd64 1.6.0-1+b1 [93.0 kB] Get: 88 http://deb.debian.org/debian unstable/main amd64 libhts3t64 amd64 1.20+ds-1 [452 kB] Get: 89 http://deb.debian.org/debian unstable/main amd64 libmodule-runtime-conflicts-perl all 0.003-2 [7356 B] Get: 90 http://deb.debian.org/debian unstable/main amd64 libpackage-deprecationmanager-perl all 0.18-1 [17.6 kB] Get: 91 http://deb.debian.org/debian unstable/main amd64 libpackage-stash-xs-perl amd64 0.30-1+b3 [20.2 kB] Get: 92 http://deb.debian.org/debian unstable/main amd64 libmoose-perl amd64 2.2207-1+b1 [766 kB] Get: 93 http://deb.debian.org/debian unstable/main amd64 libncurses6 amd64 6.5-2 [104 kB] Get: 94 http://deb.debian.org/debian unstable/main amd64 libpadwalker-perl amd64 2.5-1+b5 [18.6 kB] Get: 95 http://deb.debian.org/debian unstable/main amd64 libpath-tiny-perl all 0.144-1 [56.4 kB] Get: 96 http://deb.debian.org/debian unstable/main amd64 libsub-uplevel-perl all 0.2800-3 [14.0 kB] Get: 97 http://deb.debian.org/debian unstable/main amd64 libterm-table-perl all 0.018-1 [29.0 kB] Get: 98 http://deb.debian.org/debian unstable/main amd64 libtest-deep-perl all 1.204-1 [52.9 kB] Get: 99 http://deb.debian.org/debian unstable/main amd64 libtext-diff-perl all 1.45-2 [27.2 kB] Get: 100 http://deb.debian.org/debian unstable/main amd64 libtest-differences-perl all 0.71-1 [17.9 kB] Get: 101 http://deb.debian.org/debian unstable/main amd64 libtest-exception-perl all 0.43-3 [16.9 kB] Get: 102 http://deb.debian.org/debian unstable/main amd64 libtest2-suite-perl all 0.000162-1 [382 kB] Get: 103 http://deb.debian.org/debian unstable/main amd64 libtest-files-perl all 0.26-1 [21.6 kB] Get: 104 http://deb.debian.org/debian unstable/main amd64 libtest-warn-perl all 0.37-2 [14.5 kB] Get: 105 http://deb.debian.org/debian unstable/main amd64 libtest-most-perl all 0.38-1 [25.1 kB] Get: 106 http://deb.debian.org/debian unstable/main amd64 libtext-csv-perl all 2.04-1 [112 kB] Get: 107 http://deb.debian.org/debian unstable/main amd64 samtools amd64 1.20-3 [653 kB] Get: 108 http://deb.debian.org/debian unstable/main amd64 smalt amd64 0.7.6-13 [115 kB] Get: 109 http://deb.debian.org/debian unstable/main amd64 tabix amd64 1.20+ds-1 [483 kB] Fetched 28.5 MB in 4s (6486 kB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package sensible-utils. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19716 files and directories currently installed.) Preparing to unpack .../000-sensible-utils_0.0.22_all.deb ... Unpacking sensible-utils (0.0.22) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../001-libmagic-mgc_1%3a5.45-3_amd64.deb ... Unpacking libmagic-mgc (1:5.45-3) ... Selecting previously unselected package libmagic1t64:amd64. Preparing to unpack .../002-libmagic1t64_1%3a5.45-3_amd64.deb ... Unpacking libmagic1t64:amd64 (1:5.45-3) ... Selecting previously unselected package file. Preparing to unpack .../003-file_1%3a5.45-3_amd64.deb ... Unpacking file (1:5.45-3) ... Selecting previously unselected package gettext-base. Preparing to unpack .../004-gettext-base_0.21-14+b1_amd64.deb ... Unpacking gettext-base (0.21-14+b1) ... Selecting previously unselected package libuchardet0:amd64. Preparing to unpack .../005-libuchardet0_0.0.8-1+b1_amd64.deb ... Unpacking libuchardet0:amd64 (0.0.8-1+b1) ... Selecting previously unselected package groff-base. Preparing to unpack .../006-groff-base_1.23.0-4_amd64.deb ... Unpacking groff-base (1.23.0-4) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../007-bsdextrautils_2.40.1-4_amd64.deb ... Unpacking bsdextrautils (2.40.1-4) ... Selecting previously unselected package libpipeline1:amd64. Preparing to unpack .../008-libpipeline1_1.5.7-2_amd64.deb ... Unpacking libpipeline1:amd64 (1.5.7-2) ... Selecting previously unselected package man-db. Preparing to unpack .../009-man-db_2.12.1-1_amd64.deb ... Unpacking man-db (2.12.1-1) ... Selecting previously unselected package m4. Preparing to unpack .../010-m4_1.4.19-4_amd64.deb ... Unpacking m4 (1.4.19-4) ... Selecting previously unselected package autoconf. Preparing to unpack .../011-autoconf_2.71-3_all.deb ... Unpacking autoconf (2.71-3) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../012-autotools-dev_20220109.1_all.deb ... Unpacking autotools-dev (20220109.1) ... Selecting previously unselected package automake. Preparing to unpack .../013-automake_1%3a1.16.5-1.3_all.deb ... Unpacking automake (1:1.16.5-1.3) ... Selecting previously unselected package autopoint. Preparing to unpack .../014-autopoint_0.21-14_all.deb ... Unpacking autopoint (0.21-14) ... Selecting previously unselected package bwa. Preparing to unpack .../015-bwa_0.7.17-7+b3_amd64.deb ... Unpacking bwa (0.7.17-7+b3) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../016-libdebhelper-perl_13.15.3_all.deb ... Unpacking libdebhelper-perl (13.15.3) ... Selecting previously unselected package libtool. Preparing to unpack .../017-libtool_2.4.7-7_all.deb ... Unpacking libtool (2.4.7-7) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../018-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../019-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../020-libfile-stripnondeterminism-perl_1.14.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.14.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../021-dh-strip-nondeterminism_1.14.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.14.0-1) ... Selecting previously unselected package libelf1t64:amd64. Preparing to unpack .../022-libelf1t64_0.191-1+b1_amd64.deb ... Unpacking libelf1t64:amd64 (0.191-1+b1) ... Selecting previously unselected package dwz. Preparing to unpack .../023-dwz_0.15-1+b1_amd64.deb ... Unpacking dwz (0.15-1+b1) ... Selecting previously unselected package libicu72:amd64. Preparing to unpack .../024-libicu72_72.1-4+b1_amd64.deb ... Unpacking libicu72:amd64 (72.1-4+b1) ... Selecting previously unselected package libxml2:amd64. Preparing to unpack .../025-libxml2_2.12.7+dfsg-2_amd64.deb ... Unpacking libxml2:amd64 (2.12.7+dfsg-2) ... Selecting previously unselected package gettext. Preparing to unpack .../026-gettext_0.21-14+b1_amd64.deb ... Unpacking gettext (0.21-14+b1) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../027-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../028-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../029-debhelper_13.15.3_all.deb ... Unpacking debhelper (13.15.3) ... Selecting previously unselected package libalgorithm-c3-perl. Preparing to unpack .../030-libalgorithm-c3-perl_0.11-2_all.deb ... Unpacking libalgorithm-c3-perl (0.11-2) ... Selecting previously unselected package libalgorithm-diff-perl. Preparing to unpack .../031-libalgorithm-diff-perl_1.201-1_all.deb ... Unpacking libalgorithm-diff-perl (1.201-1) ... Selecting previously unselected package libb-hooks-op-check-perl:amd64. Preparing to unpack .../032-libb-hooks-op-check-perl_0.22-3+b1_amd64.deb ... Unpacking libb-hooks-op-check-perl:amd64 (0.22-3+b1) ... Selecting previously unselected package libbambamc0:amd64. Preparing to unpack .../033-libbambamc0_0.0.50-6+b1_amd64.deb ... Unpacking libbambamc0:amd64 (0.0.50-6+b1) ... Selecting previously unselected package libio-string-perl. Preparing to unpack .../034-libio-string-perl_1.08-4_all.deb ... Unpacking libio-string-perl (1.08-4) ... Selecting previously unselected package libdata-stag-perl. Preparing to unpack .../035-libdata-stag-perl_0.14-3_all.deb ... Unpacking libdata-stag-perl (0.14-3) ... Selecting previously unselected package libbio-perl-perl. Preparing to unpack .../036-libbio-perl-perl_1.7.8-1_all.deb ... Unpacking libbio-perl-perl (1.7.8-1) ... Selecting previously unselected package libbrotli1:amd64. Preparing to unpack .../037-libbrotli1_1.1.0-2+b3_amd64.deb ... Unpacking libbrotli1:amd64 (1.1.0-2+b3) ... Selecting previously unselected package libcapture-tiny-perl. Preparing to unpack .../038-libcapture-tiny-perl_0.48-2_all.deb ... Unpacking libcapture-tiny-perl (0.48-2) ... Selecting previously unselected package libclass-c3-perl. Preparing to unpack .../039-libclass-c3-perl_0.35-2_all.deb ... Unpacking libclass-c3-perl (0.35-2) ... Selecting previously unselected package libclass-data-inheritable-perl. Preparing to unpack .../040-libclass-data-inheritable-perl_0.08-3_all.deb ... Unpacking libclass-data-inheritable-perl (0.08-3) ... Selecting previously unselected package libparams-util-perl. Preparing to unpack .../041-libparams-util-perl_1.102-3_amd64.deb ... Unpacking libparams-util-perl (1.102-3) ... Selecting previously unselected package libsub-install-perl. Preparing to unpack .../042-libsub-install-perl_0.929-1_all.deb ... Unpacking libsub-install-perl (0.929-1) ... Selecting previously unselected package libdata-optlist-perl. Preparing to unpack .../043-libdata-optlist-perl_0.114-1_all.deb ... Unpacking libdata-optlist-perl (0.114-1) ... Selecting previously unselected package libdynaloader-functions-perl. Preparing to unpack .../044-libdynaloader-functions-perl_0.003-3_all.deb ... Unpacking libdynaloader-functions-perl (0.003-3) ... Selecting previously unselected package libdevel-callchecker-perl:amd64. Preparing to unpack .../045-libdevel-callchecker-perl_0.009-1_amd64.deb ... Unpacking libdevel-callchecker-perl:amd64 (0.009-1) ... Selecting previously unselected package libparams-classify-perl:amd64. Preparing to unpack .../046-libparams-classify-perl_0.015-2+b3_amd64.deb ... Unpacking libparams-classify-perl:amd64 (0.015-2+b3) ... Selecting previously unselected package libmodule-runtime-perl. Preparing to unpack .../047-libmodule-runtime-perl_0.016-2_all.deb ... Unpacking libmodule-runtime-perl (0.016-2) ... Selecting previously unselected package libtry-tiny-perl. Preparing to unpack .../048-libtry-tiny-perl_0.31-2_all.deb ... Unpacking libtry-tiny-perl (0.31-2) ... Selecting previously unselected package libmodule-implementation-perl. Preparing to unpack .../049-libmodule-implementation-perl_0.09-2_all.deb ... Unpacking libmodule-implementation-perl (0.09-2) ... Selecting previously unselected package libpackage-stash-perl. Preparing to unpack .../050-libpackage-stash-perl_0.40-1_all.deb ... Unpacking libpackage-stash-perl (0.40-1) ... Selecting previously unselected package libclass-load-perl. Preparing to unpack .../051-libclass-load-perl_0.25-2_all.deb ... Unpacking libclass-load-perl (0.25-2) ... Selecting previously unselected package libclass-load-xs-perl. Preparing to unpack .../052-libclass-load-xs-perl_0.10-2+b3_amd64.deb ... Unpacking libclass-load-xs-perl (0.10-2+b3) ... Selecting previously unselected package libclass-xsaccessor-perl. Preparing to unpack .../053-libclass-xsaccessor-perl_1.19-4+b3_amd64.deb ... Unpacking libclass-xsaccessor-perl (1.19-4+b3) ... Selecting previously unselected package libclone-perl:amd64. Preparing to unpack .../054-libclone-perl_0.46-1+b2_amd64.deb ... Unpacking libclone-perl:amd64 (0.46-1+b2) ... Selecting previously unselected package libcom-err2:amd64. Preparing to unpack .../055-libcom-err2_1.47.1-1_amd64.deb ... Unpacking libcom-err2:amd64 (1.47.1-1) ... Selecting previously unselected package libsub-exporter-perl. Preparing to unpack .../056-libsub-exporter-perl_0.990-1_all.deb ... Unpacking libsub-exporter-perl (0.990-1) ... Selecting previously unselected package libsub-exporter-progressive-perl. Preparing to unpack .../057-libsub-exporter-progressive-perl_0.001013-3_all.deb ... Unpacking libsub-exporter-progressive-perl (0.001013-3) ... Selecting previously unselected package libconst-fast-perl. Preparing to unpack .../058-libconst-fast-perl_0.014-2_all.deb ... Unpacking libconst-fast-perl (0.014-2) ... Selecting previously unselected package libkrb5support0:amd64. Preparing to unpack .../059-libkrb5support0_1.20.1-6+b1_amd64.deb ... Unpacking libkrb5support0:amd64 (1.20.1-6+b1) ... Selecting previously unselected package libk5crypto3:amd64. Preparing to unpack .../060-libk5crypto3_1.20.1-6+b1_amd64.deb ... Unpacking libk5crypto3:amd64 (1.20.1-6+b1) ... Selecting previously unselected package libkeyutils1:amd64. Preparing to unpack .../061-libkeyutils1_1.6.3-3_amd64.deb ... Unpacking libkeyutils1:amd64 (1.6.3-3) ... Selecting previously unselected package libkrb5-3:amd64. Preparing to unpack .../062-libkrb5-3_1.20.1-6+b1_amd64.deb ... Unpacking libkrb5-3:amd64 (1.20.1-6+b1) ... Selecting previously unselected package libgssapi-krb5-2:amd64. Preparing to unpack .../063-libgssapi-krb5-2_1.20.1-6+b1_amd64.deb ... Unpacking libgssapi-krb5-2:amd64 (1.20.1-6+b1) ... Selecting previously unselected package libsasl2-modules-db:amd64. Preparing to unpack .../064-libsasl2-modules-db_2.1.28+dfsg1-6_amd64.deb ... Unpacking libsasl2-modules-db:amd64 (2.1.28+dfsg1-6) ... Selecting previously unselected package libsasl2-2:amd64. Preparing to unpack .../065-libsasl2-2_2.1.28+dfsg1-6_amd64.deb ... Unpacking libsasl2-2:amd64 (2.1.28+dfsg1-6) ... Selecting previously unselected package libldap-2.5-0:amd64. Preparing to unpack .../066-libldap-2.5-0_2.5.17+dfsg-1_amd64.deb ... Unpacking libldap-2.5-0:amd64 (2.5.17+dfsg-1) ... Selecting previously unselected package libnghttp2-14:amd64. Preparing to unpack .../067-libnghttp2-14_1.61.0-1+b1_amd64.deb ... Unpacking libnghttp2-14:amd64 (1.61.0-1+b1) ... Selecting previously unselected package libpsl5t64:amd64. Preparing to unpack .../068-libpsl5t64_0.21.2-1.1_amd64.deb ... Unpacking libpsl5t64:amd64 (0.21.2-1.1) ... Selecting previously unselected package librtmp1:amd64. Preparing to unpack .../069-librtmp1_2.4+20151223.gitfa8646d.1-2+b4_amd64.deb ... Unpacking librtmp1:amd64 (2.4+20151223.gitfa8646d.1-2+b4) ... Selecting previously unselected package libssh2-1t64:amd64. Preparing to unpack .../070-libssh2-1t64_1.11.0-5_amd64.deb ... Unpacking libssh2-1t64:amd64 (1.11.0-5) ... Selecting previously unselected package libcurl3t64-gnutls:amd64. Preparing to unpack .../071-libcurl3t64-gnutls_8.8.0-1_amd64.deb ... Unpacking libcurl3t64-gnutls:amd64 (8.8.0-1) ... Selecting previously unselected package libnumber-compare-perl. Preparing to unpack .../072-libnumber-compare-perl_0.03-3_all.deb ... Unpacking libnumber-compare-perl (0.03-3) ... Selecting previously unselected package libtext-glob-perl. Preparing to unpack .../073-libtext-glob-perl_0.11-3_all.deb ... Unpacking libtext-glob-perl (0.11-3) ... Selecting previously unselected package libfile-find-rule-perl. Preparing to unpack .../074-libfile-find-rule-perl_0.34-3_all.deb ... Unpacking libfile-find-rule-perl (0.34-3) ... Selecting previously unselected package libdata-compare-perl. Preparing to unpack .../075-libdata-compare-perl_1.29-1_all.deb ... Unpacking libdata-compare-perl (1.29-1) ... Selecting previously unselected package libdeflate0:amd64. Preparing to unpack .../076-libdeflate0_1.20-1_amd64.deb ... Unpacking libdeflate0:amd64 (1.20-1) ... Selecting previously unselected package libdevel-globaldestruction-perl. Preparing to unpack .../077-libdevel-globaldestruction-perl_0.14-4_all.deb ... Unpacking libdevel-globaldestruction-perl (0.14-4) ... Selecting previously unselected package libmro-compat-perl. Preparing to unpack .../078-libmro-compat-perl_0.15-2_all.deb ... Unpacking libmro-compat-perl (0.15-2) ... Selecting previously unselected package libdevel-overloadinfo-perl. Preparing to unpack .../079-libdevel-overloadinfo-perl_0.007-1_all.deb ... Unpacking libdevel-overloadinfo-perl (0.007-1) ... Selecting previously unselected package libdevel-stacktrace-perl. Preparing to unpack .../080-libdevel-stacktrace-perl_2.0500-1_all.deb ... Unpacking libdevel-stacktrace-perl (2.0500-1) ... Selecting previously unselected package libdist-checkconflicts-perl. Preparing to unpack .../081-libdist-checkconflicts-perl_0.11-2_all.deb ... Unpacking libdist-checkconflicts-perl (0.11-2) ... Selecting previously unselected package libenv-path-perl. Preparing to unpack .../082-libenv-path-perl_0.19-4_all.deb ... Unpacking libenv-path-perl (0.19-4) ... Selecting previously unselected package libeval-closure-perl. Preparing to unpack .../083-libeval-closure-perl_0.14-3_all.deb ... Unpacking libeval-closure-perl (0.14-3) ... Selecting previously unselected package libexception-class-perl. Preparing to unpack .../084-libexception-class-perl_1.45-1_all.deb ... Unpacking libexception-class-perl (1.45-1) ... Selecting previously unselected package libfile-chdir-perl. Preparing to unpack .../085-libfile-chdir-perl_0.1008-1.2_all.deb ... Unpacking libfile-chdir-perl (0.1008-1.2) ... Selecting previously unselected package libhtscodecs2:amd64. Preparing to unpack .../086-libhtscodecs2_1.6.0-1+b1_amd64.deb ... Unpacking libhtscodecs2:amd64 (1.6.0-1+b1) ... Selecting previously unselected package libhts3t64:amd64. Preparing to unpack .../087-libhts3t64_1.20+ds-1_amd64.deb ... Unpacking libhts3t64:amd64 (1.20+ds-1) ... Selecting previously unselected package libmodule-runtime-conflicts-perl. Preparing to unpack .../088-libmodule-runtime-conflicts-perl_0.003-2_all.deb ... Unpacking libmodule-runtime-conflicts-perl (0.003-2) ... Selecting previously unselected package libpackage-deprecationmanager-perl. Preparing to unpack .../089-libpackage-deprecationmanager-perl_0.18-1_all.deb ... Unpacking libpackage-deprecationmanager-perl (0.18-1) ... Selecting previously unselected package libpackage-stash-xs-perl:amd64. Preparing to unpack .../090-libpackage-stash-xs-perl_0.30-1+b3_amd64.deb ... Unpacking libpackage-stash-xs-perl:amd64 (0.30-1+b3) ... Selecting previously unselected package libmoose-perl:amd64. Preparing to unpack .../091-libmoose-perl_2.2207-1+b1_amd64.deb ... Unpacking libmoose-perl:amd64 (2.2207-1+b1) ... Selecting previously unselected package libncurses6:amd64. Preparing to unpack .../092-libncurses6_6.5-2_amd64.deb ... Unpacking libncurses6:amd64 (6.5-2) ... Selecting previously unselected package libpadwalker-perl. Preparing to unpack .../093-libpadwalker-perl_2.5-1+b5_amd64.deb ... Unpacking libpadwalker-perl (2.5-1+b5) ... Selecting previously unselected package libpath-tiny-perl. Preparing to unpack .../094-libpath-tiny-perl_0.144-1_all.deb ... Unpacking libpath-tiny-perl (0.144-1) ... Selecting previously unselected package libsub-uplevel-perl. Preparing to unpack .../095-libsub-uplevel-perl_0.2800-3_all.deb ... Unpacking libsub-uplevel-perl (0.2800-3) ... Selecting previously unselected package libterm-table-perl. Preparing to unpack .../096-libterm-table-perl_0.018-1_all.deb ... Unpacking libterm-table-perl (0.018-1) ... Selecting previously unselected package libtest-deep-perl. Preparing to unpack .../097-libtest-deep-perl_1.204-1_all.deb ... Unpacking libtest-deep-perl (1.204-1) ... Selecting previously unselected package libtext-diff-perl. Preparing to unpack .../098-libtext-diff-perl_1.45-2_all.deb ... Unpacking libtext-diff-perl (1.45-2) ... Selecting previously unselected package libtest-differences-perl. Preparing to unpack .../099-libtest-differences-perl_0.71-1_all.deb ... Unpacking libtest-differences-perl (0.71-1) ... Selecting previously unselected package libtest-exception-perl. Preparing to unpack .../100-libtest-exception-perl_0.43-3_all.deb ... Unpacking libtest-exception-perl (0.43-3) ... Selecting previously unselected package libtest2-suite-perl. Preparing to unpack .../101-libtest2-suite-perl_0.000162-1_all.deb ... Unpacking libtest2-suite-perl (0.000162-1) ... Selecting previously unselected package libtest-files-perl. Preparing to unpack .../102-libtest-files-perl_0.26-1_all.deb ... Unpacking libtest-files-perl (0.26-1) ... Selecting previously unselected package libtest-warn-perl. Preparing to unpack .../103-libtest-warn-perl_0.37-2_all.deb ... Unpacking libtest-warn-perl (0.37-2) ... Selecting previously unselected package libtest-most-perl. Preparing to unpack .../104-libtest-most-perl_0.38-1_all.deb ... Unpacking libtest-most-perl (0.38-1) ... Selecting previously unselected package libtext-csv-perl. Preparing to unpack .../105-libtext-csv-perl_2.04-1_all.deb ... Unpacking libtext-csv-perl (2.04-1) ... Selecting previously unselected package samtools. Preparing to unpack .../106-samtools_1.20-3_amd64.deb ... Unpacking samtools (1.20-3) ... Selecting previously unselected package smalt. Preparing to unpack .../107-smalt_0.7.6-13_amd64.deb ... Unpacking smalt (0.7.6-13) ... Selecting previously unselected package tabix. Preparing to unpack .../108-tabix_1.20+ds-1_amd64.deb ... Unpacking tabix (1.20+ds-1) ... Setting up libhtscodecs2:amd64 (1.6.0-1+b1) ... Setting up libpipeline1:amd64 (1.5.7-2) ... Setting up libkeyutils1:amd64 (1.6.3-3) ... Setting up libicu72:amd64 (72.1-4+b1) ... Setting up libterm-table-perl (0.018-1) ... Setting up bsdextrautils (2.40.1-4) ... Setting up libdynaloader-functions-perl (0.003-3) ... Setting up libtext-glob-perl (0.11-3) ... Setting up libtest-deep-perl (1.204-1) ... Setting up libmagic-mgc (1:5.45-3) ... Setting up libclone-perl:amd64 (0.46-1+b2) ... Setting up libalgorithm-diff-perl (1.201-1) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up bwa (0.7.17-7+b3) ... Setting up libdebhelper-perl (13.15.3) ... Setting up libbrotli1:amd64 (1.1.0-2+b3) ... Setting up libmagic1t64:amd64 (1:5.45-3) ... Setting up libtry-tiny-perl (0.31-2) ... Setting up libpsl5t64:amd64 (0.21.2-1.1) ... Setting up libnghttp2-14:amd64 (1.61.0-1+b1) ... Setting up libdeflate0:amd64 (1.20-1) ... Setting up gettext-base (0.21-14+b1) ... Setting up m4 (1.4.19-4) ... Setting up libpadwalker-perl (2.5-1+b5) ... Setting up libcom-err2:amd64 (1.47.1-1) ... Setting up file (1:5.45-3) ... Setting up libsub-install-perl (0.929-1) ... Setting up libelf1t64:amd64 (0.191-1+b1) ... Setting up libtest2-suite-perl (0.000162-1) ... Setting up libkrb5support0:amd64 (1.20.1-6+b1) ... Setting up libnumber-compare-perl (0.03-3) ... Setting up libsasl2-modules-db:amd64 (2.1.28+dfsg1-6) ... Setting up libio-string-perl (1.08-4) ... Setting up libpackage-stash-xs-perl:amd64 (0.30-1+b3) ... Setting up autotools-dev (20220109.1) ... Setting up libclass-data-inheritable-perl (0.08-3) ... Setting up libalgorithm-c3-perl (0.11-2) ... Setting up libtext-diff-perl (1.45-2) ... Setting up libfile-find-rule-perl (0.34-3) ... Setting up librtmp1:amd64 (2.4+20151223.gitfa8646d.1-2+b4) ... Setting up libncurses6:amd64 (6.5-2) ... Setting up libenv-path-perl (0.19-4) ... Setting up libbambamc0:amd64 (0.0.50-6+b1) ... Setting up autopoint (0.21-14) ... Setting up libb-hooks-op-check-perl:amd64 (0.22-3+b1) ... Setting up libk5crypto3:amd64 (1.20.1-6+b1) ... Setting up libparams-util-perl (1.102-3) ... Setting up libsasl2-2:amd64 (2.1.28+dfsg1-6) ... Setting up autoconf (2.71-3) ... Setting up libsub-exporter-progressive-perl (0.001013-3) ... Setting up libcapture-tiny-perl (0.48-2) ... Setting up dwz (0.15-1+b1) ... Setting up libdata-stag-perl (0.14-3) ... Setting up libfile-chdir-perl (0.1008-1.2) ... Setting up sensible-utils (0.0.22) ... Setting up libpath-tiny-perl (0.144-1) ... Setting up libuchardet0:amd64 (0.0.8-1+b1) ... Setting up libsub-uplevel-perl (0.2800-3) ... Setting up libdevel-globaldestruction-perl (0.14-4) ... Setting up libdevel-stacktrace-perl (2.0500-1) ... Setting up libclass-xsaccessor-perl (1.19-4+b3) ... Setting up libkrb5-3:amd64 (1.20.1-6+b1) ... Setting up libbio-perl-perl (1.7.8-1) ... Setting up libssh2-1t64:amd64 (1.11.0-5) ... Setting up tabix (1.20+ds-1) ... Setting up libxml2:amd64 (2.12.7+dfsg-2) ... Setting up libtext-csv-perl (2.04-1) ... Setting up automake (1:1.16.5-1.3) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up libfile-stripnondeterminism-perl (1.14.0-1) ... Setting up smalt (0.7.6-13) ... Setting up gettext (0.21-14+b1) ... Setting up libtool (2.4.7-7) ... Setting up libtest-warn-perl (0.37-2) ... Setting up libtest-differences-perl (0.71-1) ... Setting up libexception-class-perl (1.45-1) ... Setting up libclass-c3-perl (0.35-2) ... Setting up libdevel-callchecker-perl:amd64 (0.009-1) ... Setting up libldap-2.5-0:amd64 (2.5.17+dfsg-1) ... Setting up libdata-compare-perl (1.29-1) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up dh-autoreconf (20) ... Setting up libtest-exception-perl (0.43-3) ... Setting up libgssapi-krb5-2:amd64 (1.20.1-6+b1) ... Setting up libdata-optlist-perl (0.114-1) ... Setting up dh-strip-nondeterminism (1.14.0-1) ... Setting up groff-base (1.23.0-4) ... Setting up libmro-compat-perl (0.15-2) ... Setting up libsub-exporter-perl (0.990-1) ... Setting up libeval-closure-perl (0.14-3) ... Setting up libtest-most-perl (0.38-1) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up libparams-classify-perl:amd64 (0.015-2+b3) ... Setting up libcurl3t64-gnutls:amd64 (8.8.0-1) ... Setting up man-db (2.12.1-1) ... Not building database; man-db/auto-update is not 'true'. Setting up libmodule-runtime-perl (0.016-2) ... Setting up libdist-checkconflicts-perl (0.11-2) ... Setting up libconst-fast-perl (0.014-2) ... Setting up libhts3t64:amd64 (1.20+ds-1) ... Setting up libmodule-implementation-perl (0.09-2) ... Setting up libpackage-stash-perl (0.40-1) ... Setting up debhelper (13.15.3) ... Setting up libmodule-runtime-conflicts-perl (0.003-2) ... Setting up libtest-files-perl (0.26-1) ... Setting up libclass-load-perl (0.25-2) ... Setting up samtools (1.20-3) ... Setting up libpackage-deprecationmanager-perl (0.18-1) ... Setting up libdevel-overloadinfo-perl (0.007-1) ... Setting up libclass-load-xs-perl (0.10-2+b3) ... Setting up libmoose-perl:amd64 (2.2207-1+b1) ... Processing triggers for libc-bin (2.38-11) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps I: Building the package I: user script /srv/workspace/pbuilder/952969/tmp/hooks/A99_set_merged_usr starting Not re-configuring usrmerge for unstable I: user script /srv/workspace/pbuilder/952969/tmp/hooks/A99_set_merged_usr finished hostname: Name or service not known I: Running cd /build/reproducible-path/bio-tradis-1.4.5+dfsg2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S > ../bio-tradis_1.4.5+dfsg2-2_source.changes dpkg-buildpackage: info: source package bio-tradis dpkg-buildpackage: info: source version 1.4.5+dfsg2-2 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Andreas Tille dpkg-source --before-build . dpkg-buildpackage: info: host architecture amd64 debian/rules clean dh clean dh_clean debian/rules binary dh binary dh_update_autotools_config dh_autoreconf dh_auto_configure /usr/bin/perl Makefile.PL INSTALLDIRS=vendor "OPTIMIZE=-g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/bio-tradis-1.4.5+dfsg2=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2" "LD=x86_64-linux-gnu-gcc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/bio-tradis-1.4.5+dfsg2=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wl,-z,relro" Checking if your kit is complete... Warning: the following files are missing in your kit: BioTraDISTutorial.pdf Please inform the author. Generating a Unix-style Makefile Writing Makefile for Bio::Tradis Writing MYMETA.yml and MYMETA.json dh_auto_build make -j42 make[1]: Entering directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' cp lib/Bio/Tradis/CommandLine/RunMapping.pm blib/lib/Bio/Tradis/CommandLine/RunMapping.pm cp lib/Bio/Tradis/Map.pm blib/lib/Bio/Tradis/Map.pm cp lib/Bio/Tradis/Parser/Bam.pm blib/lib/Bio/Tradis/Parser/Bam.pm cp lib/Bio/Tradis/CommandLine/TradisAnalysis.pm blib/lib/Bio/Tradis/CommandLine/TradisAnalysis.pm cp lib/Bio/Tradis/CombinePlots.pm blib/lib/Bio/Tradis/CombinePlots.pm cp lib/Bio/Tradis.pm blib/lib/Bio/Tradis.pm cp lib/Bio/Tradis/Parser/Fastq.pm blib/lib/Bio/Tradis/Parser/Fastq.pm cp lib/Bio/Tradis/Exception.pm blib/lib/Bio/Tradis/Exception.pm cp lib/Bio/Tradis/TradisPlot.pm blib/lib/Bio/Tradis/TradisPlot.pm cp lib/Bio/Tradis/Analysis/Exceptions.pm blib/lib/Bio/Tradis/Analysis/Exceptions.pm cp lib/Bio/Tradis/CommandLine/CheckTags.pm blib/lib/Bio/Tradis/CommandLine/CheckTags.pm cp lib/Bio/Tradis/CommandLine/RemoveFastqTags.pm blib/lib/Bio/Tradis/CommandLine/RemoveFastqTags.pm cp lib/Bio/Tradis/CommandLine/PlotTradis.pm blib/lib/Bio/Tradis/CommandLine/PlotTradis.pm cp lib/Bio/Tradis/DetectTags.pm blib/lib/Bio/Tradis/DetectTags.pm cp lib/Bio/Tradis/RemoveTags.pm blib/lib/Bio/Tradis/RemoveTags.pm cp lib/Bio/Tradis/AddTagsToSeq.pm blib/lib/Bio/Tradis/AddTagsToSeq.pm cp lib/Bio/Tradis/Parser/Cigar.pm blib/lib/Bio/Tradis/Parser/Cigar.pm cp lib/Bio/Tradis/CommandLine/TradisBam.pm blib/lib/Bio/Tradis/CommandLine/TradisBam.pm cp lib/Bio/Tradis/Analysis/InsertSite.pm blib/lib/Bio/Tradis/Analysis/InsertSite.pm cp lib/Bio/Tradis/CommandLine/AddTags.pm blib/lib/Bio/Tradis/CommandLine/AddTags.pm cp lib/Bio/Tradis/CommandLine/PlotCombine.pm blib/lib/Bio/Tradis/CommandLine/PlotCombine.pm cp lib/Bio/Tradis/Samtools.pm blib/lib/Bio/Tradis/Samtools.pm cp lib/Bio/Tradis/RunTradis.pm blib/lib/Bio/Tradis/RunTradis.pm cp lib/Bio/Tradis/CommandLine/FilterFastqTags.pm blib/lib/Bio/Tradis/CommandLine/FilterFastqTags.pm cp lib/Bio/Tradis/FilterTags.pm blib/lib/Bio/Tradis/FilterTags.pm cp bin/add_tradis_tags blib/script/add_tradis_tags cp bin/bacteria_tradis blib/script/bacteria_tradis cp bin/check_tradis_tags blib/script/check_tradis_tags cp bin/combine_tradis_plots blib/script/combine_tradis_plots cp bin/filter_tradis_tags blib/script/filter_tradis_tags "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/add_tradis_tags "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bacteria_tradis "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/check_tradis_tags "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/combine_tradis_plots cp bin/remove_tradis_tags blib/script/remove_tradis_tags "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/filter_tradis_tags cp bin/tradis_comparison.R blib/script/tradis_comparison.R "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/remove_tradis_tags cp bin/tradis_essentiality.R blib/script/tradis_essentiality.R cp bin/tradis_gene_insert_sites blib/script/tradis_gene_insert_sites "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tradis_comparison.R cp bin/tradis_merge_plots blib/script/tradis_merge_plots cp bin/tradis_plot blib/script/tradis_plot "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tradis_essentiality.R "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tradis_gene_insert_sites "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tradis_merge_plots "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tradis_plot Manifying 9 pod documents Manifying 25 pod documents make[1]: Leaving directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' debian/rules override_dh_auto_test make[1]: Entering directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' dh_auto_test || true make -j42 test TEST_VERBOSE=1 make[2]: Entering directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' PERL_DL_NONLAZY=1 "/usr/bin/perl" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(1, 'blib/lib', 'blib/arch')" t/*.t t/Bio/Tradis/*.t t/Bio/Tradis/Analysis/*.t t/Bio/Tradis/CommandLine/*.t t/Bio/Tradis/Parser/*.t # # Versions for all modules listed in MYMETA.json (including optional ones): # # === Configure Requires === # # Module Want Have # ------------------- ---- ---- # ExtUtils::MakeMaker any 7.70 # # === Build Requires === # # Module Want Have # ------------------- ---- ---- # ExtUtils::MakeMaker any 7.70 # # === Test Requires === # # Module Want Have # ------------------- ---- -------- # Env::Path 0.18 0.19 # ExtUtils::MakeMaker any 7.70 # File::Spec any 3.88 # Test::Exception any 0.43 # Test::Files any 0.26 # Test::More any 1.302194 # Test::Most any 0.38 # # === Test Recommends === # # Module Want Have # ---------- -------- -------- # CPAN::Meta 2.120900 2.150010 # # === Runtime Requires === # # Module Want Have # ---------------- ---- ------ # Bio::Seq any 1.7.8 # Bio::SeqIO any 1.7.8 # Cwd any 3.89 # Data::Dumper any 2.188 # Exception::Class any 1.45 # File::Basename any 2.86 # File::Path any 2.18 # File::Spec any 3.88 # File::Temp any 0.2311 # FindBin any 1.53 # Getopt::Long any 2.54 # Moose any 2.2207 # Text::CSV any 2.04 # Try::Tiny any 0.31 # strict any 1.12 # warnings any 1.65 # t/00-report-prereqs.t ...................... 1..1 ok 1 ok # Failed test 'checking file contents' # at /usr/share/perl5/Test/Files.pm line 376. # --- t/data/output.sam # +++ t/data/AddTags/expected_tradis.sam # @@ -15,9 +15,7 @@ # @PG ID:picard_markduplicates PN:Picard PP:samtools_sort VN:1.72(1230) CL:/software/java/bin/java -Xmx6000m -jar /software/solexa/bin/aligners/picard/picard-tools-1.72/MarkDuplicates.jar INPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted.bam OUTPUT=/dev/stdout METRICS_FILE=/tmp/kShEyfoGW1 ASSUME_SORTED='true' COMPRESSION_LEVEL='0' MAX_FILE_HANDLES_FOR_READ_ENDS_MAP='900' READ_NAME_REGEX='[a-zA-Z0-9_]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*' REMOVE_DUPLICATES='false' VALIDATION_STRINGENCY='SILENT' VERBOSITY='ERROR' # @PG ID:ChangeBamHeader PN:ChangeBamHeader PP:picard_markduplicates DS:Add extra PGs into bam header, or change SM, LB or DS tag in RG line in header and this only works with one read group in the input bam. VN:V1.10 CL:uk.ac.sanger.npg.picard.ChangeBamHeader INPUT=/dev/stdin OUTPUT=/dev/stdout PG=[ID:samtools_sort;PN:samtools;VN:0.1.18 (r982:295);CL:/software/solexa/bin/aligners/samtools/samtools-0.1.18/samtools sort /nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/9521_1#14.bam /nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted, ID:picard_markduplicates;PN:Picard;VN:1.72(1230);CL:/software/java/bin/java -Xmx6000m -jar /software/solexa/bin/aligners/picard/picard-tools-1.72/MarkDuplicates.jar INPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted.bam OUTPUT=/dev/stdout METRICS_FILE=/tmp/kShEyfoGW1 ASSUME_SORTED='true' COMPRESSION_LEVEL='0' MAX_FILE_HANDLES_FOR_READ_ENDS_MAP='900' READ_NAME_REGEX='[a-zA-Z0-9_]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*' REMOVE_DUPLICATES='false' VALIDATION_STRINGENCY='SILENT' VERBOSITY='ERROR'] TMP_DIR=[/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb] VERBOSITY=INFO VALIDATION_STRINGENCY=SILENT COMPRESSION_LEVEL=0 QUIET=false MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false # @PG ID:BamTagStripper PN:BamTagStripper PP:ChangeBamHeader DS:Strip a list of tags in bam/sam record. By default, any tags containing lowercase letters will be stripped and other tags will be kept. A list of tags can be given to keep or strip VN:V1.10 CL:uk.ac.sanger.npg.picard.BamTagStripper INPUT=/dev/stdin OUTPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/9521_1#14_mk.bam TAG_TO_KEEP=[a3, ah, br, qr, tq, tr] TAG_TO_STRIP=[OQ] TMP_DIR=[/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb] VERBOSITY=INFO VALIDATION_STRINGENCY=SILENT CREATE_INDEX=true CREATE_MD5_FILE=true QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 # -@PG ID:samtools PN:samtools PP:BamTagStripper VN:1.20 CL:samtools view -H t/data/AddTags/sample_sm_tr.bam # -@PG ID:samtools.1 PN:samtools PP:samtools VN:1.20 CL:samtools view -h -S -b -o t/data/output.bam tmp.20250703055949.sam # -@PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.20 CL:samtools view -h -o t/data/output.sam t/data/output.bam # +@PG ID:samtools PN:samtools PP:BamTagStripper VN:1.20 CL:samtools view -h -o t/data/AddTags/expected_tradis.sam t/data/AddTags/expected_tradis.bam # MS5_9521:1:1101:10072:14269#14 16 ENA|AE004091|AE004091.2 5 37 60M * 0 0 AAGAGACCGGCGATTCTAGTGAAATCGAACGGGCAGGTCAATTTCCAACCCTGACTCTTA HHHGGGGGGGHHHHHHHHHHHGHHHGHHGGGGGGGGGGFFFBFFCBAABAFFFFFBBCCC X0:i:1 X1:i:0 BC:Z:TCTCGGTT MD:Z:50 RG:Z:1#14 XG:i:0 NM:i:0 XM:i:0 XO:i:0 QT:Z:BBCDECBC XT:A:U tq:Z:CCCBBFFFFF tr:Z:TAAGAGTCAG # MS5_9521:1:1103:26809:18585#14 1040 ENA|AE004091|AE004091.2 23 37 60M * 0 0 GTGAAATCGAACGGGCAGGTCAATTTCCAACCAGCGATGACGTAATAGATCTGACTCTTA 5FGGHHGEGHFEHHHHHGFHHGHGGHGFGGFCGEGBBAFC?DFFFBBBB3FFFFFCCCCB X0:i:1 X1:i:0 BC:Z:TCTCGGTT MD:Z:50 RG:Z:1#14 XG:i:0 NM:i:0 XM:i:0 XO:i:0 QT:Z:CCCCCCCC XT:A:U tq:Z:BCCCCFFFFF tr:Z:TAAGAGTCAG # MS5_9521:1:2101:3627:15042#14 16 ENA|AE004091|AE004091.2 23 37 60M * 0 0 GTGAAATCGAACGGGCAGGTCAATTTCCAACCAGCGATGACGTAATAGATCTGACTCTTA HHHGHHHGHHGGHHHHHHHHHHHHHHGGGGGGGGGGGGFFCFFFFBBBAAFFFFFCBAAA X0:i:1 X1:i:0 BC:Z:TCTCGGTT MD:Z:50 RG:Z:1#14 XG:i:0 NM:i:0 XM:i:0 XO:i:0 QT:Z:AAA>AAAA XT:A:U tq:Z:AAABCFFFFF tr:Z:TAAGAGTCAG # Failed test 'checking file contents' # at /usr/share/perl5/Test/Files.pm line 376. # --- t/data/AddTags/sample_sm_no_tr.sam # +++ t/data/output.sam # @@ -15,7 +15,9 @@ # @PG ID:picard_markduplicates PN:Picard PP:samtools_sort VN:1.72(1230) CL:/software/java/bin/java -Xmx6000m -jar /software/solexa/bin/aligners/picard/picard-tools-1.72/MarkDuplicates.jar INPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted.bam OUTPUT=/dev/stdout METRICS_FILE=/tmp/kShEyfoGW1 ASSUME_SORTED='true' COMPRESSION_LEVEL='0' MAX_FILE_HANDLES_FOR_READ_ENDS_MAP='900' READ_NAME_REGEX='[a-zA-Z0-9_]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*' REMOVE_DUPLICATES='false' VALIDATION_STRINGENCY='SILENT' VERBOSITY='ERROR' # @PG ID:ChangeBamHeader PN:ChangeBamHeader PP:picard_markduplicates DS:Add extra PGs into bam header, or change SM, LB or DS tag in RG line in header and this only works with one read group in the input bam. VN:V1.10 CL:uk.ac.sanger.npg.picard.ChangeBamHeader INPUT=/dev/stdin OUTPUT=/dev/stdout PG=[ID:samtools_sort;PN:samtools;VN:0.1.18 (r982:295);CL:/software/solexa/bin/aligners/samtools/samtools-0.1.18/samtools sort /nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/9521_1#14.bam /nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted, ID:picard_markduplicates;PN:Picard;VN:1.72(1230);CL:/software/java/bin/java -Xmx6000m -jar /software/solexa/bin/aligners/picard/picard-tools-1.72/MarkDuplicates.jar INPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted.bam OUTPUT=/dev/stdout METRICS_FILE=/tmp/kShEyfoGW1 ASSUME_SORTED='true' COMPRESSION_LEVEL='0' MAX_FILE_HANDLES_FOR_READ_ENDS_MAP='900' READ_NAME_REGEX='[a-zA-Z0-9_]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*' REMOVE_DUPLICATES='false' VALIDATION_STRINGENCY='SILENT' VERBOSITY='ERROR'] TMP_DIR=[/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb] VERBOSITY=INFO VALIDATION_STRINGENCY=SILENT COMPRESSION_LEVEL=0 QUIET=false MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false # @PG ID:BamTagStripper PN:BamTagStripper PP:ChangeBamHeader DS:Strip a list of tags in bam/sam record. By default, any tags containing lowercase letters will be stripped and other tags will be kept. A list of tags can be given to keep or strip VN:V1.10 CL:uk.ac.sanger.npg.picard.BamTagStripper INPUT=/dev/stdin OUTPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/9521_1#14_mk.bam TAG_TO_KEEP=[a3, ah, br, qr, tq, tr] TAG_TO_STRIP=[OQ] TMP_DIR=[/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb] VERBOSITY=INFO VALIDATION_STRINGENCY=SILENT CREATE_INDEX=true CREATE_MD5_FILE=true QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 # -@PG ID:samtools PN:samtools PP:BamTagStripper VN:1.20 CL:samtools view -h -o t/data/AddTags/sample_sm_no_tr.sam t/data/AddTags/sample_sm_no_tr.bam # +@PG ID:samtools PN:samtools PP:BamTagStripper VN:1.20 CL:samtools view -H t/data/AddTags/sample_sm_tr.bam # +@PG ID:samtools.1 PN:samtools PP:samtools VN:1.20 CL:samtools view -h -S -b -o t/data/output.bam tmp.20250703055949.sam # +@PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.20 CL:samtools view -h -o t/data/output.sam t/data/output.bam # MS5_9521:1:1101:10072:14269#14 16 ENA|AE004091|AE004091.2 5 37 60M * 0 0 AAGAGACCGGCGATTCTAGTGAAATCGAACGGGCAGGTCAATTTCCAACCCTGACTCTTA HHHGGGGGGGHHHHHHHHHHHGHHHGHHGGGGGGGGGGFFFBFFCBAABAFFFFFBBCCC X0:i:1 X1:i:0 BC:Z:TCTCGGTT MD:Z:50 RG:Z:1#14 XG:i:0 NM:i:0 XM:i:0 XO:i:0 QT:Z:BBCDECBC XT:A:U tq:Z:CCCBBFFFFF tr:Z:TAAGAGTCAG # MS5_9521:1:1103:26809:18585#14 1040 ENA|AE004091|AE004091.2 23 37 60M * 0 0 GTGAAATCGAACGGGCAGGTCAATTTCCAACCAGCGATGACGTAATAGATCTGACTCTTA 5FGGHHGEGHFEHHHHHGFHHGHGGHGFGGFCGEGBBAFC?DFFFBBBB3FFFFFCCCCB X0:i:1 X1:i:0 BC:Z:TCTCGGTT MD:Z:50 RG:Z:1#14 XG:i:0 NM:i:0 XM:i:0 XO:i:0 QT:Z:CCCCCCCC XT:A:U tq:Z:BCCCCFFFFF tr:Z:TAAGAGTCAG # MS5_9521:1:2101:3627:15042#14 16 ENA|AE004091|AE004091.2 23 37 60M * 0 0 GTGAAATCGAACGGGCAGGTCAATTTCCAACCAGCGATGACGTAATAGATCTGACTCTTA HHHGHHHGHHGGHHHHHHHHHHHHHHGGGGGGGGGGGGFFCFFFFBBBAAFFFFFCBAAA X0:i:1 X1:i:0 BC:Z:TCTCGGTT MD:Z:50 RG:Z:1#14 XG:i:0 NM:i:0 XM:i:0 XO:i:0 QT:Z:AAA>AAAA XT:A:U tq:Z:AAABCFFFFF tr:Z:TAAGAGTCAG [W::find_file_url] Failed to open reference "https://www.ebi.ac.uk/ena/cram/md5/7f8b730b8a08ebf1eeb7f0de561f0a91": Destination address required [E::fai_build3_core] Failed to open the file /nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta : No such file or directory [E::refs_load_fai] Failed to open reference file '/nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta' [W::cram_get_ref] Failed to populate reference for id 0 [E::cram_decode_slice] Unable to fetch reference #0:5-193 [E::cram_next_slice] Failure to decode slice samtools view: error reading file "t/data/AddTags/sample_sm_tr.cram": No such file or directory [W::find_file_url] Failed to open reference "https://www.ebi.ac.uk/ena/cram/md5/7f8b730b8a08ebf1eeb7f0de561f0a91": Destination address required [E::fai_build3_core] Failed to open the file /nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta : No such file or directory [E::refs_load_fai] Failed to open reference file '/nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta' [W::cram_get_ref] Failed to populate reference for id 0 [E::cram_decode_slice] Unable to fetch reference #0:5-193 [E::cram_next_slice] Failure to decode slice samtools view: error reading file "t/data/AddTags/sample_sm_tr.cram": No such file or directory [W::find_file_url] Failed to open reference "https://www.ebi.ac.uk/ena/cram/md5/7f8b730b8a08ebf1eeb7f0de561f0a91": Destination address required [E::fai_build3_core] Failed to open the file /nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta : No such file or directory [E::refs_load_fai] Failed to open reference file '/nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta' [W::cram_get_ref] Failed to populate reference for id 0 [E::cram_decode_slice] Unable to fetch reference #0:5-203 [E::cram_next_slice] Failure to decode slice samtools view: error reading file "t/data/AddTags/expected_tradis.cram": No such file or directory # Failed test 'checking file contents' # at /usr/share/perl5/Test/Files.pm line 376. # --- t/data/output.sam # +++ t/data/AddTags/expected_tradis.sam # @@ -1,4 +1,6 @@ # @HD VN:1.4 SO:coordinate # +@RG ID:1#14 PL:ILLUMINA PU:130320_MS5_9521_A_MS0205701-050V2_1#14 LB:6982965 DS:ERP002335: http://www.sanger.ac.uk/resources/downloads/bacteria/citrobacter-rodentium.html This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ DT:2013-03-20T00:00:00+0000 SM:ERS222909 CN:SC # +@SQ SN:ENA|AE004091|AE004091.2 LN:6264404 UR:file:/nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta AS:PAO1 M5:7f8b730b8a08ebf1eeb7f0de561f0a91 SP:Pseudomonas aeruginosa # @PG ID:SCS PN:MiSeq Control Software DS:Controlling software on instrument VN:2.2.0 # @PG ID:basecalling PN:RTA PP:SCS DS:Basecalling Package VN:1.17.28.0 # @PG ID:Illumina2bam PN:Illumina2bam PP:basecalling DS:Convert Illumina BCL to BAM or SAM file VN:V1.10 CL:uk.ac.sanger.npg.illumina.Illumina2bam INTENSITY_DIR=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities BASECALLS_DIR=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BaseCalls LANE=1 OUTPUT=/dev/stdout SAMPLE_ALIAS=ERS222824,ERS222825,ERS222825,ERS222824,ERS222909,ERS222910 LIBRARY_NAME=6983166 STUDY_NAME=ERP002335: http://www.sanger.ac.uk/resources/downloads/bacteria/citrobacter-rodentium.html This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ BARCODE_SEQUENCE_TAG_NAME=tr BARCODE_QUALITY_TAG_NAME=tq SECOND_BARCODE_SEQUENCE_TAG_NAME=BC SECOND_BARCODE_QUALITY_TAG_NAME=QT COMPRESSION_LEVEL=0 CREATE_MD5_FILE=true GENERATE_SECONDARY_BASE_CALLS=false PF_FILTER=true READ_GROUP_ID=1 SEQUENCING_CENTER=SC PLATFORM=ILLUMINA VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false # @@ -13,8 +15,4 @@ # @PG ID:picard_markduplicates PN:Picard PP:samtools_sort VN:1.72(1230) CL:/software/java/bin/java -Xmx6000m -jar /software/solexa/bin/aligners/picard/picard-tools-1.72/MarkDuplicates.jar INPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted.bam OUTPUT=/dev/stdout METRICS_FILE=/tmp/kShEyfoGW1 ASSUME_SORTED='true' COMPRESSION_LEVEL='0' MAX_FILE_HANDLES_FOR_READ_ENDS_MAP='900' READ_NAME_REGEX='[a-zA-Z0-9_]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*' REMOVE_DUPLICATES='false' VALIDATION_STRINGENCY='SILENT' VERBOSITY='ERROR' # @PG ID:ChangeBamHeader PN:ChangeBamHeader PP:picard_markduplicates DS:Add extra PGs into bam header, or change SM, LB or DS tag in RG line in header and this only works with one read group in the input bam. VN:V1.10 CL:uk.ac.sanger.npg.picard.ChangeBamHeader INPUT=/dev/stdin OUTPUT=/dev/stdout PG=[ID:samtools_sort;PN:samtools;VN:0.1.18 (r982:295);CL:/software/solexa/bin/aligners/samtools/samtools-0.1.18/samtools sort /nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/9521_1#14.bam /nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted, ID:picard_markduplicates;PN:Picard;VN:1.72(1230);CL:/software/java/bin/java -Xmx6000m -jar /software/solexa/bin/aligners/picard/picard-tools-1.72/MarkDuplicates.jar INPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted.bam OUTPUT=/dev/stdout METRICS_FILE=/tmp/kShEyfoGW1 ASSUME_SORTED='true' COMPRESSION_LEVEL='0' MAX_FILE_HANDLES_FOR_READ_ENDS_MAP='900' READ_NAME_REGEX='[a-zA-Z0-9_]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*' REMOVE_DUPLICATES='false' VALIDATION_STRINGENCY='SILENT' VERBOSITY='ERROR'] TMP_DIR=[/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb] VERBOSITY=INFO VALIDATION_STRINGENCY=SILENT COMPRESSION_LEVEL=0 QUIET=false MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false # @PG ID:BamTagStripper PN:BamTagStripper PP:ChangeBamHeader DS:Strip a list of tags in bam/sam record. By default, any tags containing lowercase letters will be stripped and other tags will be kept. A list of tags can be given to keep or strip VN:V1.10 CL:uk.ac.sanger.npg.picard.BamTagStripper INPUT=/dev/stdin OUTPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/9521_1#14_mk.bam TAG_TO_KEEP=[a3, ah, br, qr, tq, tr] TAG_TO_STRIP=[OQ] TMP_DIR=[/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb] VERBOSITY=INFO VALIDATION_STRINGENCY=SILENT CREATE_INDEX=true CREATE_MD5_FILE=true QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 # -@PG ID:samtools PN:samtools PP:BamTagStripper VN:1.20 CL:samtools view -H t/data/AddTags/sample_sm_tr.cram # +@PG ID:samtools PN:samtools PP:BamTagStripper VN:1.20 CL:samtools view -h -o t/data/AddTags/expected_tradis.sam t/data/AddTags/expected_tradis.cram # -@PG ID:samtools.1 PN:samtools PP:samtools VN:1.20 CL:samtools view -h -S -C -o t/data/output.cram tmp.20250703055951.sam # -@PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.20 CL:samtools view -h -o t/data/output.sam t/data/output.cram # -@SQ SN:ENA|AE004091|AE004091.2 LN:6264404 UR:file:/nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta AS:PAO1 M5:7f8b730b8a08ebf1eeb7f0de561f0a91 SP:Pseudomonas aeruginosa # -@RG ID:1#14 PL:ILLUMINA PU:130320_MS5_9521_A_MS0205701-050V2_1#14 LB:6982965 DS:ERP002335: http://www.sanger.ac.uk/resources/downloads/bacteria/citrobacter-rodentium.html This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ DT:2013-03-20T00:00:00+0000 SM:ERS222909 CN:SC # Looks like you failed 3 tests of 15. t/Bio/Tradis/AddTagsToSeq.t ................ ok 1 - use Bio::Tradis::AddTagsToSeq; ok 2 - creating object ok 3 - correctly select the bam output switch ok 4 - testing output ok 5 - checking file existence not ok 6 - checking file contents ok 7 - creating object ok 8 - checking file existence not ok 9 - checking file contents ok 10 - number of reads as expected ok 11 - creating object with cram file ok 12 - correctly select the cram output switch ok 13 - testing output ok 14 - checking file existence not ok 15 - checking file contents 1..15 Dubious, test returned 3 (wstat 768, 0x300) Failed 3/15 subtests t/Bio/Tradis/Analysis/InsertSite.t ......... ok 1 - use Bio::Tradis::Analysis::InsertSite; ok 2 ok 3 ok 4 - check main sequence insert_site values first value ok 5 - check main sequence insert_site value before site ok 6 - check main sequence insert_site values for reverse reads only ok 7 - various values ok 8 - various values ok 9 - various values ok 10 - various values ok 11 - various values ok 12 - check empty plasmid insert_site values first value ok 13 - check empty plasmid insert_site values last value ok 14 - check plasmid with 1 read insert_site values first value ok 15 - check plasmid with 1 read insert_site values first base of read ok 16 - check plasmid with 1 read insert_site values after last base of read ok 17 - check plasmid with 1 read insert_site values last value ok 18 - check another empty plasmid insert_site values first value ok 19 - check another empty plasmid insert_site values last value ok 20 ok 21 ok 22 - check forward read ok 23 - check reverse read 1..23 ok [W::tbx_parse1] Coordinate <= 0 detected. Did you forget to use the -0 option? [W::tbx_parse1] Coordinate <= 0 detected. Did you forget to use the -0 option? [tabix] the index file exists. Please use '-f' to overwrite. t/Bio/Tradis/CombinePlots.t ................ ok 1 - use Bio::Tradis::CombinePlots; ok 2 - creating object ok 3 - combining plots ok 4 - checking first combined plot file exists ok 5 - checking second combined plot file exists ok 6 - checking stats file exists ok 7 - checking first file contents ok 8 - checking second file contents ok 9 - checking stats file contents ok 10 - creating object ok 11 - combining plots ok 12 - checking first combined plot file exists ok 13 - checking tabix sorted combined plot file exists ok 14 - checking tabix index file exists ok 15 - checking zipped file contents ok 16 - checking stats file contents ok 17 - creating object ok 18 - combining plots ok 19 - checking directory exists ok 20 - checking first combined plot file exists ok 21 - checking second combined plot file exists 1..21 ok Attribute (_stats_handle) does not pass the type constraint because: Validation failed for 'FileHandle' with value GLOB(0x55f8b6fa1be0) at reader Bio::Tradis::CommandLine::TradisAnalysis::_stats_handle (defined at lib/Bio/Tradis/CommandLine/TradisAnalysis.pm line 43) line 15 Bio::Tradis::CommandLine::TradisAnalysis::_stats_handle('Bio::Tradis::CommandLine::TradisAnalysis=HASH(0x55f8b6fa1478)') called at lib/Bio/Tradis/CommandLine/TradisAnalysis.pm line 146 Bio::Tradis::CommandLine::TradisAnalysis::run('Bio::Tradis::CommandLine::TradisAnalysis=HASH(0x55f8b6fa1478)') called at t/Bio/Tradis/CommandLine/TradisAnalysis.t line 33 # Tests were run but no plan was declared and done_testing() was not seen. # Looks like your test exited with 255 just after 2. t/Bio/Tradis/CommandLine/TradisAnalysis.t .. ok 1 - use Bio::Tradis::CommandLine::TradisAnalysis; ok 2 - creating object Dubious, test returned 255 (wstat 65280, 0xff00) All 2 subtests passed [W::find_file_url] Failed to open reference "https://www.ebi.ac.uk/ena/cram/md5/7f8b730b8a08ebf1eeb7f0de561f0a91": Destination address required t/Bio/Tradis/DetectTags.t .................. ok 1 - use Bio::Tradis::DetectTags; ok 2 - testing tag checker - tradis ok 3 - testing output ok 4 - testing tag checker for cram- tradis ok 5 - testing output cram ok 6 - testing tag checker - no tradis ok 7 - testing output 1..7 ok t/Bio/Tradis/FilterTags.t .................. ok 1 - use Bio::Tradis::FilterTags; ok 2 - creating object ok 3 - testing output ok 4 - checking file existence ok 5 - checking file contents ok 6 - creating object ok 7 - testing output ok 8 - checking file existence ok 9 - checking file contents ok 10 - creating object ok 11 - testing output ok 12 - checking file existence ok 13 - checking file contents ok 14 - creating object ok 15 - testing output ok 16 - checking file existence ok 17 - checking file contents 1..17 ok t/Bio/Tradis/Map.t ......................... ok 1 - use Bio::Tradis::Map; ok 2 - creating object ok 3 - testing reference indexing ok 4 - checking index file existence ok 5 - checking index file existence ok 6 - testing smalt mapping ok 7 - checking index file existence ok 8 - checking file contents ok 9 - creating object ok 10 - testing reference indexing ok 11 - checking index file existence ok 12 - checking index file existence ok 13 - checking index file existence ok 14 - checking index file existence ok 15 - checking index file existence ok 16 - testing bwa mapping ok 17 - checking index file existence ok 18 - checking file contents ok 19 - creating object ok 20 - indexing args correct ok 21 - mapping args correct 1..21 ok t/Bio/Tradis/Parser/Bam.t .................. ok 1 - use Bio::Tradis::Parser::Bam; ok 2 - creating object ok 3 - An object of class 'Bio::Tradis::Parser::Bam' isa 'Bio::Tradis::Parser::Bam' ok 4 - seq_info returns a hash ok 5 - first result detected ok 6 - read_info contains correct info for first line ok 7 - testing flag parsing - mapped ok 8 - testing flag parsing - reverse complement ok 9 - last result detected ok 10 - read_info contains correct info for last line ok 11 - EOF detected 1..11 ok t/Bio/Tradis/Parser/Cigar.t ................ ok 1 - use Bio::Tradis::Parser::Cigar; ok 2 - initialise obj -all matching ok 3 - read start -all matching ok 4 - read end -all matching ok 5 - initialise obj -nothing matching ok 6 - read start -nothing matching ok 7 - read end -nothing matching ok 8 - initialise obj -soft clipping at start ok 9 - read start -soft clipping at start ok 10 - read end -soft clipping at start ok 11 - initialise obj -soft clipping at end ok 12 - read start -soft clipping at end ok 13 - read end -soft clipping at end ok 14 - initialise obj -soft clipping at both ends ok 15 - read start -soft clipping at both ends ok 16 - read end -soft clipping at both ends ok 17 - initialise obj -deletion in middle ok 18 - read start -deletion in middle ok 19 - read end -deletion in middle ok 20 - initialise obj -insertions and deletions ok 21 - read start -insertions and deletions ok 22 - read end -insertions and deletions ok 23 - initialise obj -insertions in the middle ok 24 - read start -insertions in the middle ok 25 - read end -insertions in the middle 1..25 ok t/Bio/Tradis/Parser/Fastq.t ................ ok 1 - use Bio::Tradis::Parser::Fastq; ok 2 - creating object ok 3 - An object of class 'Bio::Tradis::Parser::Fastq' isa 'Bio::Tradis::Parser::Fastq' ok 4 - first result detected ok 5 - read_info contains correct info for first line ok 6 - last result detected ok 7 - read_info contains correct info for last line ok 8 - EOF detected 1..8 ok t/Bio/Tradis/RemoveTags.t .................. ok 1 - use Bio::Tradis::RemoveTags; ok 2 - creating object ok 3 - testing output ok 4 - checking file existence ok 5 - checking file contents ok 6 - creating object ok 7 - testing output ok 8 - checking file existence ok 9 - checking file contents ok 10 - creating object ok 11 - testing output ok 12 - checking file existence ok 13 - checking file contents 1..13 ok t/Bio/Tradis/RunTradisBWA.t ................ ok 1 - use Bio::Tradis::RunTradis; ok 2 - creating object - Normal files, no mismatch ok 3 - testing filtering step ok 4 - checking filtered file existence - Normal files, no mismatch ok 5 - checking filtered file contents - Normal files, no mismatch ok 6 - testing check filtering step ok 7 - complain if no filtered reads ok 8 - complain if filtered reads are empty ok 9 - complain if filtered reads has less than 4 lines ok 10 - complain if filtered reads do not look like a fastq ok 11 - complain if filtered reads are too short ok 12 - check very basic filtered reads validation ok 13 - testing tag removal ok 14 - checking de-tagged file existence - Normal files, no mismatch ok 15 - checking de-tagged file contents - Normal files, no mismatch ok 16 - testing mapping ok 17 - checking SAM existence ok 18 - checking mapped file contents ok 19 - testing SAM/BAM conversion ok 20 - checking BAM existence ok 21 - testing BAM sorting ok 22 - checking sorted BAM existence - Normal files, no mismatch ok 23 - checking indexed BAM existence - Normal files, no mismatch ok 24 - testing bamcheck ok 25 - checking bamcheck file existence - Normal files, no mismatch ok 26 - testing plotting ok 27 - checking plot file existence - Normal files, no mismatch ok 28 - checking plot file contents - Normal files, no mismatch ok 29 - testing complete analysis - Normal files, no mismatch ok 30 - checking plot file existence - Normal files, no mismatch ok 31 - checking completed pipeline file contents - Normal files, no mismatch ok 32 - creating object - Normal files one mismatch ok 33 - testing complete analysis with mismatch ok 34 - checking plot file existence - Normal files one mismatch ok 35 - checking completed pipeline with mismatch file contents - Normal files one mismatch ok 36 - creating object with gzipped data - Normal files one mismatch ok 37 - testing complete analysis with gzipped data ok 38 - checking plot file existence (gzipped data) - Normal files one mismatch ok 39 - checking mapped bam existence - Normal files one mismatch ok 40 - checking indexed bam file - Normal files one mismatch ok 41 - checking completed pipeline with gzipped data file contents - Normal files one mismatch ok 42 - creating object with custom smalt parameters ok 43 - mapping with custom parameters fine ok 44 - creating object ok 45 - correct error thrown 1..45 ok t/Bio/Tradis/RunTradisSmalt.t .............. ok 1 - use Bio::Tradis::RunTradis; ok 2 - creating object - Normal files, no mismatch ok 3 - testing filtering step ok 4 - checking filtered file existence - Normal files, no mismatch ok 5 - checking filtered file contents - Normal files, no mismatch ok 6 - testing check filtering step ok 7 - complain if no filtered reads ok 8 - complain if filtered reads are empty ok 9 - complain if filtered reads has less than 4 lines ok 10 - complain if filtered reads do not look like a fastq ok 11 - complain if filtered reads are too short ok 12 - check very basic filtered reads validation ok 13 - testing tag removal ok 14 - checking de-tagged file existence - Normal files, no mismatch ok 15 - checking de-tagged file contents - Normal files, no mismatch ok 16 - testing mapping ok 17 - checking SAM existence ok 18 - checking mapped file contents ok 19 - testing SAM/BAM conversion ok 20 - checking BAM existence ok 21 - testing BAM sorting ok 22 - checking sorted BAM existence - Normal files, no mismatch ok 23 - checking indexed BAM existence - Normal files, no mismatch ok 24 - testing bamcheck ok 25 - checking bamcheck file existence - Normal files, no mismatch ok 26 - testing plotting ok 27 - checking plot file existence - Normal files, no mismatch ok 28 - checking plot file contents - Normal files, no mismatch ok 29 - testing complete analysis - Normal files, no mismatch ok 30 - checking plot file existence - Normal files, no mismatch ok 31 - checking completed pipeline file contents - Normal files, no mismatch ok 32 - creating object - Normal files one mismatch ok 33 - testing complete analysis with mismatch ok 34 - checking plot file existence - Normal files one mismatch ok 35 - checking completed pipeline with mismatch file contents - Normal files one mismatch ok 36 - creating object with gzipped data - Normal files one mismatch ok 37 - testing complete analysis with gzipped data ok 38 - checking plot file existence (gzipped data) - Normal files one mismatch ok 39 - checking mapped bam existence - Normal files one mismatch ok 40 - checking indexed bam file - Normal files one mismatch ok 41 - checking completed pipeline with gzipped data file contents - Normal files one mismatch ok 42 - creating object with custom smalt parameters ok 43 - mapping with custom parameters fine ok 44 - creating object with custom smalt parameters ok 45 - correct error thrown 1..45 ok t/Bio/Tradis/RunTradisTaglessBwa.t ......... ok 1 - use Bio::Tradis::RunTradis; ok 2 - creating object - Normal files, no mismatch ok 3 - testing mapping ok 4 - checking SAM existence ok 5 - checking mapped file contents ok 6 - testing SAM/BAM conversion ok 7 - checking BAM existence ok 8 - testing BAM sorting ok 9 - checking sorted BAM existence - Normal files, no mismatch ok 10 - checking indexed BAM existence - Normal files, no mismatch ok 11 - testing bamcheck ok 12 - checking bamcheck file existence - Normal files, no mismatch ok 13 - testing plotting ok 14 - checking plot file existence - Normal files, no mismatch ok 15 - checking plot file contents - Normal files, no mismatch ok 16 - testing complete analysis - Normal files, no mismatch ok 17 - checking plot file existence - Normal files, no mismatch ok 18 - checking completed pipeline file contents - Normal files, no mismatch ok 19 - creating object with custom smalt parameters ok 20 - mapping with custom parameters fine ok 21 - creating object ok 22 - correct error thrown 1..22 ok t/Bio/Tradis/RunTradisTaglessSmalt.t ....... ok 1 - use Bio::Tradis::RunTradis; ok 2 - creating object - Normal files, no mismatch ok 3 - testing mapping ok 4 - checking SAM existence ok 5 - checking mapped file contents ok 6 - testing SAM/BAM conversion ok 7 - checking BAM existence ok 8 - testing BAM sorting ok 9 - checking sorted BAM existence - Normal files, no mismatch ok 10 - checking indexed BAM existence - Normal files, no mismatch ok 11 - testing bamcheck ok 12 - checking bamcheck file existence - Normal files, no mismatch ok 13 - testing plotting ok 14 - checking plot file existence - Normal files, no mismatch ok 15 - checking plot file contents - Normal files, no mismatch ok 16 - testing complete analysis - Normal files, no mismatch ok 17 - checking plot file existence - Normal files, no mismatch ok 18 - checking completed pipeline file contents - Normal files, no mismatch ok 19 - creating object with custom smalt parameters ok 20 - mapping with custom parameters fine ok 21 - creating object with custom smalt parameters ok 22 - correct error thrown 1..22 ok t/Bio/Tradis/TradisPlot.t .................. ok 1 - use Bio::Tradis::TradisPlot; ok 2 - creating object ok 3 - testing plotting ok 4 - checking plot file existence ok 5 - checking file contents 1..5 ok t/requires_external.t ...................... 1..6 ok 1 - awk in PATH ok 2 - samtools in PATH ok 3 - gunzip in PATH ok 4 - gzip in PATH ok 5 - smalt in PATH ok 6 - tabix in PATH ok Test Summary Report ------------------- t/Bio/Tradis/AddTagsToSeq.t (Wstat: 768 (exited 3) Tests: 15 Failed: 3) Failed tests: 6, 9, 15 Non-zero exit status: 3 t/Bio/Tradis/CommandLine/TradisAnalysis.t (Wstat: 65280 (exited 255) Tests: 2 Failed: 0) Non-zero exit status: 255 Parse errors: No plan found in TAP output Files=18, Tests=309, 12 wallclock secs ( 0.09 usr 0.04 sys + 6.30 cusr 1.89 csys = 8.32 CPU) Result: FAIL Failed 2/18 test programs. 3/309 subtests failed. make[2]: *** [Makefile:1077: test_dynamic] Error 255 make[2]: Leaving directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' dh_auto_test: error: make -j42 test TEST_VERBOSE=1 returned exit code 2 make[1]: Leaving directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' create-stamp debian/debhelper-build-stamp dh_prep dh_auto_install --destdir=debian/bio-tradis/ make -j42 install DESTDIR=/build/reproducible-path/bio-tradis-1.4.5\+dfsg2/debian/bio-tradis AM_UPDATE_INFO_DIR=no PREFIX=/usr make[1]: Entering directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' Manifying 9 pod documents Manifying 25 pod documents Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/AddTagsToSeq.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Map.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CombinePlots.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/DetectTags.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/RunTradis.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/TradisPlot.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/RemoveTags.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Exception.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/FilterTags.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Samtools.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/FilterFastqTags.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/TradisBam.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/TradisAnalysis.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/CheckTags.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/RemoveFastqTags.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/RunMapping.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/PlotTradis.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/PlotCombine.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/AddTags.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Analysis/InsertSite.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Analysis/Exceptions.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Parser/Bam.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Parser/Cigar.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Parser/Fastq.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man1/combine_tradis_plots.1p Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man1/filter_tradis_tags.1p Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man1/bacteria_tradis.1p Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man1/tradis_plot.1p Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man1/remove_tradis_tags.1p Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man1/tradis_gene_insert_sites.1p Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man1/check_tradis_tags.1p Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man1/add_tradis_tags.1p Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man1/tradis_merge_plots.1p Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::TradisPlot.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CombinePlots.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Analysis::Exceptions.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::TradisAnalysis.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::RunTradis.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Exception.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::AddTags.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::AddTagsToSeq.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::RemoveTags.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Analysis::InsertSite.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::RunMapping.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::PlotCombine.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::FilterFastqTags.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Map.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::FilterTags.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::RemoveFastqTags.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::PlotTradis.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Parser::Bam.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::TradisBam.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::CheckTags.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Parser::Fastq.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::DetectTags.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Samtools.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Parser::Cigar.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/tradis_merge_plots Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/bacteria_tradis Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/tradis_essentiality.R Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/check_tradis_tags Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/add_tradis_tags Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/combine_tradis_plots Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/remove_tradis_tags Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/filter_tradis_tags Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/tradis_gene_insert_sites Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/tradis_plot Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/tradis_comparison.R make[1]: Leaving directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' debian/rules override_dh_install make[1]: Entering directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' dh_install for pl in `grep -Rl '#!/usr/bin/env[[:space:]]\+perl' debian/*/usr/*` ; do \ sed -i '1s?^#!/usr/bin/env[[:space:]]\+perl?#!/usr/bin/perl?' ${pl} ; \ done mv debian/bio-tradis/usr/bin/tradis_comparison.R debian/bio-tradis/usr/bin/tradis_comparison mv debian/bio-tradis/usr/bin/tradis_essentiality.R debian/bio-tradis/usr/bin/tradis_essentiality make[1]: Leaving directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' dh_installdocs dh_installchangelogs debian/rules override_dh_installman make[1]: Entering directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' dh_installman rm debian/bio-tradis/usr/share/man/man1/tradis_merge_plots.1p* make[1]: Leaving directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' dh_perl dh_link dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'bio-tradis' in '../bio-tradis_1.4.5+dfsg2-2_all.deb'. dpkg-genbuildinfo --build=binary -O../bio-tradis_1.4.5+dfsg2-2_amd64.buildinfo dpkg-genchanges --build=binary -O../bio-tradis_1.4.5+dfsg2-2_amd64.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: user script /srv/workspace/pbuilder/952969/tmp/hooks/B01_cleanup starting I: user script /srv/workspace/pbuilder/952969/tmp/hooks/B01_cleanup finished I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/952969 and its subdirectories I: Current time: Thu Jul 3 20:00:05 +14 2025 I: pbuilder-time-stamp: 1751522405