Diff of the two buildlogs: -- --- b1/build.log 2024-04-30 22:19:28.095871266 +0000 +++ b2/build.log 2024-04-30 22:27:21.831688066 +0000 @@ -1,6 +1,6 @@ I: pbuilder: network access will be disabled during build -I: Current time: Mon Jun 2 16:38:10 -12 2025 -I: pbuilder-time-stamp: 1748925490 +I: Current time: Wed May 1 12:19:32 +14 2024 +I: pbuilder-time-stamp: 1714515572 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/trixie-reproducible-base.tgz] I: copying local configuration @@ -31,54 +31,86 @@ dpkg-source: info: applying flaky_test.patch I: Not using root during the build. I: Installing the build-deps -I: user script /srv/workspace/pbuilder/73035/tmp/hooks/D02_print_environment starting +I: user script /srv/workspace/pbuilder/51452/tmp/hooks/D01_modify_environment starting +debug: Running on ionos12-i386. +I: Changing host+domainname to test build reproducibility +I: Adding a custom variable just for the fun of it... +I: Changing /bin/sh to bash +'/bin/sh' -> '/bin/bash' +lrwxrwxrwx 1 root root 9 Apr 30 22:19 /bin/sh -> /bin/bash +I: Setting pbuilder2's login shell to /bin/bash +I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other +I: user script /srv/workspace/pbuilder/51452/tmp/hooks/D01_modify_environment finished +I: user script /srv/workspace/pbuilder/51452/tmp/hooks/D02_print_environment starting I: set - BUILDDIR='/build/reproducible-path' - BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' - BUILDUSERNAME='pbuilder1' - BUILD_ARCH='i386' - DEBIAN_FRONTEND='noninteractive' - DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=22 ' - DISTRIBUTION='trixie' - HOME='/root' - HOST_ARCH='i386' + BASH=/bin/sh + BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:globskipdots:hostcomplete:interactive_comments:patsub_replacement:progcomp:promptvars:sourcepath + BASH_ALIASES=() + BASH_ARGC=() + BASH_ARGV=() + BASH_CMDS=() + BASH_LINENO=([0]="12" [1]="0") + BASH_LOADABLES_PATH=/usr/local/lib/bash:/usr/lib/bash:/opt/local/lib/bash:/usr/pkg/lib/bash:/opt/pkg/lib/bash:. + BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment") + BASH_VERSINFO=([0]="5" [1]="2" [2]="21" [3]="1" [4]="release" [5]="i686-pc-linux-gnu") + BASH_VERSION='5.2.21(1)-release' + BUILDDIR=/build/reproducible-path + BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other' + BUILDUSERNAME=pbuilder2 + BUILD_ARCH=i386 + DEBIAN_FRONTEND=noninteractive + DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=10 ' + DIRSTACK=() + DISTRIBUTION=trixie + EUID=0 + FUNCNAME=([0]="Echo" [1]="main") + GROUPS=() + HOME=/root + HOSTNAME=i-capture-the-hostname + HOSTTYPE=i686 + HOST_ARCH=i386 IFS=' ' - INVOCATION_ID='e9a4dac763684e8d97fe0062378851e0' - LANG='C' - LANGUAGE='en_US:en' - LC_ALL='C' - LD_LIBRARY_PATH='/usr/lib/libeatmydata' - LD_PRELOAD='libeatmydata.so' - MAIL='/var/mail/root' - OPTIND='1' - PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' - PBCURRENTCOMMANDLINEOPERATION='build' - PBUILDER_OPERATION='build' - PBUILDER_PKGDATADIR='/usr/share/pbuilder' - PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' - PBUILDER_SYSCONFDIR='/etc' - PPID='73035' - PS1='# ' - PS2='> ' + INVOCATION_ID=c51e147bebb64020a23d6f741e2a8130 + LANG=C + LANGUAGE=de_CH:de + LC_ALL=C + LD_LIBRARY_PATH=/usr/lib/libeatmydata + LD_PRELOAD=libeatmydata.so + MACHTYPE=i686-pc-linux-gnu + MAIL=/var/mail/root + OPTERR=1 + OPTIND=1 + OSTYPE=linux-gnu + PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path + PBCURRENTCOMMANDLINEOPERATION=build + PBUILDER_OPERATION=build + PBUILDER_PKGDATADIR=/usr/share/pbuilder + PBUILDER_PKGLIBDIR=/usr/lib/pbuilder + PBUILDER_SYSCONFDIR=/etc + PIPESTATUS=([0]="0") + POSIXLY_CORRECT=y + PPID=51452 PS4='+ ' - PWD='/' - SHELL='/bin/bash' - SHLVL='2' - SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.tSIZNE7f/pbuilderrc_IiID --distribution trixie --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.tSIZNE7f/b1 --logfile b1/build.log milib_2.2.0+dfsg-1.dsc' - SUDO_GID='112' - SUDO_UID='107' - SUDO_USER='jenkins' - TERM='unknown' - TZ='/usr/share/zoneinfo/Etc/GMT+12' - USER='root' - _='/usr/bin/systemd-run' - http_proxy='http://213.165.73.152:3128' + PWD=/ + SHELL=/bin/bash + SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix + SHLVL=3 + SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.tSIZNE7f/pbuilderrc_rVYO --distribution trixie --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.tSIZNE7f/b2 --logfile b2/build.log milib_2.2.0+dfsg-1.dsc' + SUDO_GID=112 + SUDO_UID=107 + SUDO_USER=jenkins + TERM=unknown + TZ=/usr/share/zoneinfo/Etc/GMT-14 + UID=0 + USER=root + _='I: set' + http_proxy=http://46.16.76.132:3128 I: uname -a - Linux ionos16-i386 6.1.0-20-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.1.85-1 (2024-04-11) x86_64 GNU/Linux + Linux i-capture-the-hostname 6.1.0-20-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.1.85-1 (2024-04-11) x86_64 GNU/Linux I: ls -l /bin - lrwxrwxrwx 1 root root 7 May 27 17:46 /bin -> usr/bin -I: user script /srv/workspace/pbuilder/73035/tmp/hooks/D02_print_environment finished + lrwxrwxrwx 1 root root 7 Apr 21 07:12 /bin -> usr/bin +I: user script /srv/workspace/pbuilder/51452/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy @@ -91,7 +123,7 @@ Depends: debhelper-compat (= 13), default-jdk, gradle-debian-helper, javahelper, maven-repo-helper, junit4, libcommons-compress-java, libcommons-io-java, libcommons-math3-java, libguava-java, libjackson2-annotations-java, libjackson2-core-java, libjackson2-databind-java, libjcommander-java, liblz4-java, libmockito-java, libredberry-pipe-java, libtrove3-java dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. -(Reading database ... 19709 files and directories currently installed.) +(Reading database ... 19885 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: @@ -223,248 +255,242 @@ 63) libclone-perl [0.46-1+b1 (testing)] 64) libcloudproviders0 [0.3.5-1 (testing)] 65) libcolord2 [1.4.7-1+b1 (testing)] -66) libcom-err2 [1.47.0-2.4 (testing)] -67) libcommons-codec-java [1.16.0-1 (testing)] -68) libcommons-collections3-java [3.2.2-3 (testing)] -69) libcommons-lang-java [2.6-10 (testing)] -70) libcommons-logging-java [1.3.0-1 (testing)] -71) libcryptsetup12 [2:2.6.1-6+b1 (testing)] -72) libcups2t64 [2.4.7-1.2+b1 (testing)] -73) libdatrie1 [0.2.13-3 (testing)] -74) libdb5.3t64 [5.3.28+dfsg2-7 (testing)] -75) libdbus-1-3 [1.14.10-4+b1 (testing)] -76) libdconf1 [0.40.0-4+b2 (testing)] -77) libdd-plist-java [1.20-1.1 (testing)] -78) libdeflate0 [1.20-1 (testing)] -79) libdevel-callchecker-perl [0.008-2+b1 (testing)] -80) libdevmapper1.02.1 [2:1.02.196-1+b1 (testing)] -81) libdom4j-java [2.1.4-1 (testing)] -82) libdrm-amdgpu1 [2.4.120-2 (testing)] -83) libdrm-common [2.4.120-2 (testing)] -84) libdrm-intel1 [2.4.120-2 (testing)] -85) libdrm-nouveau2 [2.4.120-2 (testing)] -86) libdrm-radeon1 [2.4.120-2 (testing)] -87) libdrm2 [2.4.120-2 (testing)] -88) libdynaloader-functions-perl [0.003-3 (testing)] -89) libeclipse-jdt-annotation-java [2.2.700+eclipse4.26-2 (testing)] -90) libedit2 [3.1-20230828-1+b1 (testing)] -91) libel-api-java [3.0.0-3 (testing)] -92) libencode-locale-perl [1.05-3 (testing)] -93) libepoxy0 [1.5.10-1+b2 (testing)] -94) libexpat1 [2.6.2-1 (testing)] -95) libfdisk1 [2.39.3-6 (testing)] -96) libfelix-framework-java [4.6.1-2.1 (testing)] -97) libfelix-gogo-runtime-java [0.16.2-1.1 (testing)] -98) libfelix-resolver-java [1.16.0-1 (testing)] -99) libfile-dirlist-perl [0.05-3 (testing)] -100) libfile-homedir-perl [1.006-2 (testing)] -101) libfile-listing-perl [6.16-1 (testing)] -102) libfile-touch-perl [0.12-2 (testing)] -103) libfile-which-perl [1.27-2 (testing)] -104) libfindbugs-java [3.1.0~preview2-3 (testing)] -105) libfontconfig1 [2.15.0-1.1 (testing)] -106) libfontenc1 [1:1.1.8-1 (testing)] -107) libfreetype6 [2.13.2+dfsg-1+b4 (testing)] -108) libfribidi0 [1.0.13-3+b1 (testing)] -109) libgdk-pixbuf-2.0-0 [2.42.10+dfsg-3+b3 (testing)] -110) libgdk-pixbuf2.0-common [2.42.10+dfsg-3 (testing)] -111) libgif7 [5.2.2-1 (testing)] -112) libgl1 [1.7.0-1+b1 (testing)] -113) libgl1-mesa-dri [23.3.5-1 (testing)] -114) libglapi-mesa [23.3.5-1 (testing)] -115) libglib2.0-0t64 [2.78.4-7 (testing)] -116) libglvnd0 [1.7.0-1+b1 (testing)] -117) libglx-mesa0 [23.3.5-1 (testing)] -118) libglx0 [1.7.0-1+b1 (testing)] -119) libgoogle-gson-java [2.10.1-1 (testing)] -120) libgradle-core-java [4.4.1-20 (testing)] -121) libgradle-plugins-java [4.4.1-20 (testing)] -122) libgraphite2-3 [1.3.14-2 (testing)] -123) libgssapi-krb5-2 [1.20.1-5+b1 (testing)] -124) libgtk-3-0t64 [3.24.41-4 (testing)] -125) libgtk-3-common [3.24.41-4 (testing)] -126) libharfbuzz0b [8.3.0-2+b1 (testing)] -127) libhawtjni-runtime-java [1.18-1 (testing)] -128) libhtml-parser-perl [3.81-1+b1 (testing)] -129) libhtml-tagset-perl [3.24-1 (testing)] -130) libhtml-tree-perl [5.07-3 (testing)] -131) libhttp-cookies-perl [6.11-1 (testing)] -132) libhttp-date-perl [6.06-1 (testing)] -133) libhttp-message-perl [6.45-1 (testing)] -134) libhttp-negotiate-perl [6.01-2 (testing)] -135) libhttpclient-java [4.5.14-1 (testing)] -136) libhttpcore-java [4.4.16-1 (testing)] -137) libimport-into-perl [1.002005-2 (testing)] -138) libio-html-perl [1.004-3 (testing)] -139) libio-pty-perl [1:1.20-1 (testing)] -140) libio-socket-ssl-perl [2.085-1 (testing)] -141) libipc-run-perl [20231003.0-2 (testing)] -142) libjansi-java [2.4.1-2 (testing)] -143) libjansi-native-java [1.8-2 (testing)] -144) libjansi1-java [1.18-3 (testing)] -145) libjarjar-java [1.4+svn142-12 (testing)] -146) libjatl-java [0.2.3-1.1 (testing)] -147) libjavaewah-java [1.2.3-1 (testing)] -148) libjaxen-java [1.1.6-4 (testing)] -149) libjbig0 [2.1-6.1+b1 (testing)] -150) libjcifs-java [1.3.19-2 (testing)] -151) libjcip-annotations-java [20060626-6 (testing)] -152) libjetty9-java [9.4.54-1 (testing)] -153) libjformatstring-java [0.10~20131207-2.1 (testing)] -154) libjgit-java [4.11.9-2 (testing)] -155) libjline2-java [2.14.6-5 (testing)] -156) libjna-java [5.14.0-1 (testing)] -157) libjna-jni [5.14.0-1 (testing)] -158) libjpeg62-turbo [1:2.1.5-2+b2 (testing)] -159) libjs-jquery [3.6.1+dfsg+~3.5.14-1 (testing)] -160) libjsch-java [0.1.55-1 (testing)] -161) libjson-c5 [0.17-1+b1 (testing)] -162) libjsoup-java [1.15.3-1 (testing)] -163) libjsp-api-java [2.3.4-3 (testing)] -164) libjzlib-java [1.1.3-3 (testing)] -165) libk5crypto3 [1.20.1-5+b1 (testing)] -166) libkeyutils1 [1.6.3-3 (testing)] -167) libkmod2 [31+20240202-2 (testing)] -168) libkrb5-3 [1.20.1-5+b1 (testing)] -169) libkrb5support0 [1.20.1-5+b1 (testing)] -170) libkryo-java [2.20-7 (testing)] -171) liblcms2-2 [2.14-2+b1 (testing)] -172) liblerc4 [4.0.0+ds-4+b1 (testing)] -173) libllvm17t64 [1:17.0.6-11 (testing)] -174) liblogback-java [1:1.2.11-5 (testing)] -175) liblwp-mediatypes-perl [6.04-2 (testing)] -176) liblwp-protocol-https-perl [6.14-1 (testing)] -177) libminlog-java [1.3.0-1.1 (testing)] -178) libmodule-runtime-perl [0.016-2 (testing)] -179) libmoo-perl [2.005005-1 (testing)] -180) libnative-platform-java [0.14-6 (testing)] -181) libnative-platform-jni [0.14-6 (testing)] -182) libnekohtml-java [1.9.22.noko2-0.1 (testing)] -183) libnet-http-perl [6.23-1 (testing)] -184) libnet-ssleay-perl [1.94-1 (testing)] -185) libnspr4 [2:4.35-1.1+b1 (testing)] -186) libnss3 [2:3.99-1 (testing)] -187) libosgi-annotation-java [8.1.0-1 (testing)] -188) libosgi-compendium-java [7.0.0-1 (testing)] -189) libosgi-core-java [8.0.0-2 (testing)] -190) libpam-systemd [255.4-1 (testing)] -191) libpango-1.0-0 [1.52.1+ds-1 (testing)] -192) libpangocairo-1.0-0 [1.52.1+ds-1 (testing)] -193) libpangoft2-1.0-0 [1.52.1+ds-1 (testing)] -194) libparams-classify-perl [0.015-2+b2 (testing)] -195) libpciaccess0 [0.17-3+b1 (testing)] -196) libpcsclite1 [2.0.1-1+b1 (testing)] -197) libpixman-1-0 [0.42.2-1+b1 (testing)] -198) libplexus-container-default-java [2.1.1-1 (testing)] -199) libpng16-16t64 [1.6.43-5 (testing)] -200) libpolyglot-maven-java [0.8~tobrien+git20120905-10 (testing)] -201) libproc2-0 [2:4.0.4-4 (testing)] -202) libpython3-stdlib [3.11.8-1 (testing)] -203) libpython3.11-minimal [3.11.9-1 (testing)] -204) libpython3.11-stdlib [3.11.9-1 (testing)] -205) libqdox-java [1.12.1-3 (testing)] -206) libreflectasm-java [1.11.9+dfsg-4 (testing)] -207) librhino-java [1.7.14-2.1 (testing)] -208) librole-tiny-perl [2.002004-1 (testing)] -209) libsensors-config [1:3.6.0-9 (testing)] -210) libsensors5 [1:3.6.0-9 (testing)] -211) libservlet-api-java [4.0.1-2 (testing)] -212) libsharpyuv0 [1.3.2-0.4+b1 (testing)] -213) libsimple-http-java [4.1.21-1.1 (testing)] -214) libssl3t64 [3.2.1-3 (testing)] -215) libsub-quote-perl [2.006008-1 (testing)] -216) libsystemd-shared [255.4-1 (testing)] -217) libthai-data [0.1.29-2 (testing)] -218) libthai0 [0.1.29-2 (testing)] -219) libtiff6 [4.5.1+git230720-4 (testing)] -220) libtimedate-perl [2.3300-2 (testing)] -221) libtry-tiny-perl [0.31-2 (testing)] -222) liburi-perl [5.28-1 (testing)] -223) libvulkan1 [1.3.280.0-1 (testing)] -224) libwagon-file-java [3.5.3-1 (testing)] -225) libwagon-http-java [3.5.3-1 (testing)] -226) libwayland-client0 [1.22.0-2.1+b1 (testing)] -227) libwayland-cursor0 [1.22.0-2.1+b1 (testing)] -228) libwayland-egl1 [1.22.0-2.1+b1 (testing)] -229) libwebp7 [1.3.2-0.4+b1 (testing)] -230) libwebsocket-api-java [1.1-2 (testing)] -231) libwww-perl [6.77-1 (testing)] -232) libwww-robotrules-perl [6.02-1 (testing)] -233) libx11-6 [2:1.8.7-1+b1 (testing)] -234) libx11-data [2:1.8.7-1 (testing)] -235) libx11-xcb1 [2:1.8.7-1+b1 (testing)] -236) libxau6 [1:1.0.9-1+b1 (testing)] -237) libxbean-reflect-java [4.5-8 (testing)] -238) libxcb-dri2-0 [1.15-1 (testing)] -239) libxcb-dri3-0 [1.15-1 (testing)] -240) libxcb-glx0 [1.15-1 (testing)] -241) libxcb-present0 [1.15-1 (testing)] -242) libxcb-randr0 [1.15-1 (testing)] -243) libxcb-render0 [1.15-1 (testing)] -244) libxcb-shm0 [1.15-1 (testing)] -245) libxcb-sync1 [1.15-1 (testing)] -246) libxcb-xfixes0 [1.15-1 (testing)] -247) libxcb1 [1.15-1 (testing)] -248) libxcomposite1 [1:0.4.5-1+b1 (testing)] -249) libxcursor1 [1:1.2.1-1+b1 (testing)] -250) libxdamage1 [1:1.1.6-1+b1 (testing)] -251) libxdmcp6 [1:1.1.2-3+b1 (testing)] -252) libxerces2-java [2.12.2-1 (testing)] -253) libxext6 [2:1.3.4-1+b1 (testing)] -254) libxfixes3 [1:6.0.0-2+b1 (testing)] -255) libxi6 [2:1.8.1-1 (testing)] -256) libxinerama1 [2:1.1.4-3+b1 (testing)] -257) libxkbcommon0 [1.6.0-1+b1 (testing)] -258) libxml-commons-external-java [1.4.01-6 (testing)] -259) libxml-commons-resolver1.1-java [1.2-11 (testing)] -260) libxpp3-java [1.1.4c-3 (testing)] -261) libxrandr2 [2:1.5.4-1 (testing)] -262) libxrender1 [1:0.9.10-1.1+b1 (testing)] -263) libxshmfence1 [1.3-1+b1 (testing)] -264) libxstream-java [1.4.20-1 (testing)] -265) libxtst6 [2:1.2.3-1.1+b1 (testing)] -266) libxxf86vm1 [1:1.1.4-1+b2 (testing)] -267) libxz-java [1.9-1 (testing)] -268) libyaml-snake-java [1.33-2 (testing)] -269) libz3-4 [4.8.12-3.1+b2 (testing)] -270) maven-repo-helper [1.11 (testing)] -271) media-types [10.1.0 (testing)] -272) netbase [6.4 (testing)] -273) openjdk-17-jdk [17.0.11+9-1 (testing)] -274) openjdk-17-jdk-headless [17.0.11+9-1 (testing)] -275) openjdk-17-jre [17.0.11+9-1 (testing)] -276) openjdk-17-jre-headless [17.0.11+9-1 (testing)] -277) openssl [3.2.1-3 (testing)] -278) patchutils [0.4.2-1 (testing)] -279) perl-openssl-defaults [7+b2 (testing)] -280) procps [2:4.0.4-4 (testing)] -281) python3 [3.11.8-1 (testing)] -282) python3-minimal [3.11.8-1 (testing)] -283) python3.11 [3.11.9-1 (testing)] -284) python3.11-minimal [3.11.9-1 (testing)] -285) shared-mime-info [2.4-1 (testing)] -286) systemd [255.4-1 (testing)] -287) systemd-dev [255.4-1 (testing)] -288) systemd-sysv [255.4-1 (testing)] -289) testng [6.9.12-4 (testing)] -290) tzdata [2024a-3 (testing)] -291) unzip [6.0-28 (testing)] -292) wdiff [1.2.2-6 (testing)] -293) x11-common [1:7.7+23 (testing)] -294) xfonts-encodings [1:1.0.4-2.2 (testing)] -295) xfonts-utils [1:7.7+6 (testing)] -296) xkb-data [2.41-2 (testing)] +66) libcommons-codec-java [1.16.0-1 (testing)] +67) libcommons-collections3-java [3.2.2-3 (testing)] +68) libcommons-lang-java [2.6-10 (testing)] +69) libcommons-logging-java [1.3.0-1 (testing)] +70) libcryptsetup12 [2:2.6.1-6+b1 (testing)] +71) libcups2t64 [2.4.7-1.2+b1 (testing)] +72) libdatrie1 [0.2.13-3 (testing)] +73) libdb5.3t64 [5.3.28+dfsg2-7 (testing)] +74) libdbus-1-3 [1.14.10-4+b1 (testing)] +75) libdconf1 [0.40.0-4+b2 (testing)] +76) libdd-plist-java [1.20-1.1 (testing)] +77) libdeflate0 [1.20-1 (testing)] +78) libdevel-callchecker-perl [0.008-2+b1 (testing)] +79) libdevmapper1.02.1 [2:1.02.196-1+b1 (testing)] +80) libdom4j-java [2.1.4-1 (testing)] +81) libdrm-amdgpu1 [2.4.120-2 (testing)] +82) libdrm-common [2.4.120-2 (testing)] +83) libdrm-intel1 [2.4.120-2 (testing)] +84) libdrm-nouveau2 [2.4.120-2 (testing)] +85) libdrm-radeon1 [2.4.120-2 (testing)] +86) libdrm2 [2.4.120-2 (testing)] +87) libdynaloader-functions-perl [0.003-3 (testing)] +88) libeclipse-jdt-annotation-java [2.2.700+eclipse4.26-2 (testing)] +89) libedit2 [3.1-20230828-1+b1 (testing)] +90) libel-api-java [3.0.0-3 (testing)] +91) libencode-locale-perl [1.05-3 (testing)] +92) libepoxy0 [1.5.10-1+b2 (testing)] +93) libexpat1 [2.6.2-1 (testing)] +94) libfdisk1 [2.39.3-6 (testing)] +95) libfelix-framework-java [4.6.1-2.1 (testing)] +96) libfelix-gogo-runtime-java [0.16.2-1.1 (testing)] +97) libfelix-resolver-java [1.16.0-1 (testing)] +98) libfile-dirlist-perl [0.05-3 (testing)] +99) libfile-homedir-perl [1.006-2 (testing)] +100) libfile-listing-perl [6.16-1 (testing)] +101) libfile-touch-perl [0.12-2 (testing)] +102) libfile-which-perl [1.27-2 (testing)] +103) libfindbugs-java [3.1.0~preview2-3 (testing)] +104) libfontconfig1 [2.15.0-1.1 (testing)] +105) libfontenc1 [1:1.1.8-1 (testing)] +106) libfreetype6 [2.13.2+dfsg-1+b4 (testing)] +107) libfribidi0 [1.0.13-3+b1 (testing)] +108) libgdk-pixbuf-2.0-0 [2.42.10+dfsg-3+b3 (testing)] +109) libgdk-pixbuf2.0-common [2.42.10+dfsg-3 (testing)] +110) libgif7 [5.2.2-1 (testing)] +111) libgl1 [1.7.0-1+b1 (testing)] +112) libgl1-mesa-dri [23.3.5-1 (testing)] +113) libglapi-mesa [23.3.5-1 (testing)] +114) libglib2.0-0t64 [2.78.4-7 (testing)] +115) libglvnd0 [1.7.0-1+b1 (testing)] +116) libglx-mesa0 [23.3.5-1 (testing)] +117) libglx0 [1.7.0-1+b1 (testing)] +118) libgoogle-gson-java [2.10.1-1 (testing)] +119) libgradle-core-java [4.4.1-20 (testing)] +120) libgradle-plugins-java [4.4.1-20 (testing)] +121) libgraphite2-3 [1.3.14-2 (testing)] +122) libgtk-3-0t64 [3.24.41-4 (testing)] +123) libgtk-3-common [3.24.41-4 (testing)] +124) libharfbuzz0b [8.3.0-2+b1 (testing)] +125) libhawtjni-runtime-java [1.18-1 (testing)] +126) libhtml-parser-perl [3.81-1+b1 (testing)] +127) libhtml-tagset-perl [3.24-1 (testing)] +128) libhtml-tree-perl [5.07-3 (testing)] +129) libhttp-cookies-perl [6.11-1 (testing)] +130) libhttp-date-perl [6.06-1 (testing)] +131) libhttp-message-perl [6.45-1 (testing)] +132) libhttp-negotiate-perl [6.01-2 (testing)] +133) libhttpclient-java [4.5.14-1 (testing)] +134) libhttpcore-java [4.4.16-1 (testing)] +135) libimport-into-perl [1.002005-2 (testing)] +136) libio-html-perl [1.004-3 (testing)] +137) libio-pty-perl [1:1.20-1 (testing)] +138) libio-socket-ssl-perl [2.085-1 (testing)] +139) libipc-run-perl [20231003.0-2 (testing)] +140) libjansi-java [2.4.1-2 (testing)] +141) libjansi-native-java [1.8-2 (testing)] +142) libjansi1-java [1.18-3 (testing)] +143) libjarjar-java [1.4+svn142-12 (testing)] +144) libjatl-java [0.2.3-1.1 (testing)] +145) libjavaewah-java [1.2.3-1 (testing)] +146) libjaxen-java [1.1.6-4 (testing)] +147) libjbig0 [2.1-6.1+b1 (testing)] +148) libjcifs-java [1.3.19-2 (testing)] +149) libjcip-annotations-java [20060626-6 (testing)] +150) libjetty9-java [9.4.54-1 (testing)] +151) libjformatstring-java [0.10~20131207-2.1 (testing)] +152) libjgit-java [4.11.9-2 (testing)] +153) libjline2-java [2.14.6-5 (testing)] +154) libjna-java [5.14.0-1 (testing)] +155) libjna-jni [5.14.0-1 (testing)] +156) libjpeg62-turbo [1:2.1.5-2+b2 (testing)] +157) libjs-jquery [3.6.1+dfsg+~3.5.14-1 (testing)] +158) libjsch-java [0.1.55-1 (testing)] +159) libjson-c5 [0.17-1+b1 (testing)] +160) libjsoup-java [1.15.3-1 (testing)] +161) libjsp-api-java [2.3.4-3 (testing)] +162) libjzlib-java [1.1.3-3 (testing)] +163) libkmod2 [31+20240202-2 (testing)] +164) libkryo-java [2.20-7 (testing)] +165) liblcms2-2 [2.14-2+b1 (testing)] +166) liblerc4 [4.0.0+ds-4+b1 (testing)] +167) libllvm17t64 [1:17.0.6-11 (testing)] +168) liblogback-java [1:1.2.11-5 (testing)] +169) liblwp-mediatypes-perl [6.04-2 (testing)] +170) liblwp-protocol-https-perl [6.14-1 (testing)] +171) libminlog-java [1.3.0-1.1 (testing)] +172) libmodule-runtime-perl [0.016-2 (testing)] +173) libmoo-perl [2.005005-1 (testing)] +174) libnative-platform-java [0.14-6 (testing)] +175) libnative-platform-jni [0.14-6 (testing)] +176) libnekohtml-java [1.9.22.noko2-0.1 (testing)] +177) libnet-http-perl [6.23-1 (testing)] +178) libnet-ssleay-perl [1.94-1 (testing)] +179) libnspr4 [2:4.35-1.1+b1 (testing)] +180) libnss3 [2:3.99-1 (testing)] +181) libosgi-annotation-java [8.1.0-1 (testing)] +182) libosgi-compendium-java [7.0.0-1 (testing)] +183) libosgi-core-java [8.0.0-2 (testing)] +184) libpam-systemd [255.4-1 (testing)] +185) libpango-1.0-0 [1.52.1+ds-1 (testing)] +186) libpangocairo-1.0-0 [1.52.1+ds-1 (testing)] +187) libpangoft2-1.0-0 [1.52.1+ds-1 (testing)] +188) libparams-classify-perl [0.015-2+b2 (testing)] +189) libpciaccess0 [0.17-3+b1 (testing)] +190) libpcsclite1 [2.0.1-1+b1 (testing)] +191) libpixman-1-0 [0.42.2-1+b1 (testing)] +192) libplexus-container-default-java [2.1.1-1 (testing)] +193) libpng16-16t64 [1.6.43-5 (testing)] +194) libpolyglot-maven-java [0.8~tobrien+git20120905-10 (testing)] +195) libproc2-0 [2:4.0.4-4 (testing)] +196) libpython3-stdlib [3.11.8-1 (testing)] +197) libpython3.11-minimal [3.11.9-1 (testing)] +198) libpython3.11-stdlib [3.11.9-1 (testing)] +199) libqdox-java [1.12.1-3 (testing)] +200) libreflectasm-java [1.11.9+dfsg-4 (testing)] +201) librhino-java [1.7.14-2.1 (testing)] +202) librole-tiny-perl [2.002004-1 (testing)] +203) libsensors-config [1:3.6.0-9 (testing)] +204) libsensors5 [1:3.6.0-9 (testing)] +205) libservlet-api-java [4.0.1-2 (testing)] +206) libsharpyuv0 [1.3.2-0.4+b1 (testing)] +207) libsimple-http-java [4.1.21-1.1 (testing)] +208) libssl3t64 [3.2.1-3 (testing)] +209) libsub-quote-perl [2.006008-1 (testing)] +210) libsystemd-shared [255.4-1 (testing)] +211) libthai-data [0.1.29-2 (testing)] +212) libthai0 [0.1.29-2 (testing)] +213) libtiff6 [4.5.1+git230720-4 (testing)] +214) libtimedate-perl [2.3300-2 (testing)] +215) libtry-tiny-perl [0.31-2 (testing)] +216) liburi-perl [5.28-1 (testing)] +217) libvulkan1 [1.3.280.0-1 (testing)] +218) libwagon-file-java [3.5.3-1 (testing)] +219) libwagon-http-java [3.5.3-1 (testing)] +220) libwayland-client0 [1.22.0-2.1+b1 (testing)] +221) libwayland-cursor0 [1.22.0-2.1+b1 (testing)] +222) libwayland-egl1 [1.22.0-2.1+b1 (testing)] +223) libwebp7 [1.3.2-0.4+b1 (testing)] +224) libwebsocket-api-java [1.1-2 (testing)] +225) libwww-perl [6.77-1 (testing)] +226) libwww-robotrules-perl [6.02-1 (testing)] +227) libx11-6 [2:1.8.7-1+b1 (testing)] +228) libx11-data [2:1.8.7-1 (testing)] +229) libx11-xcb1 [2:1.8.7-1+b1 (testing)] +230) libxau6 [1:1.0.9-1+b1 (testing)] +231) libxbean-reflect-java [4.5-8 (testing)] +232) libxcb-dri2-0 [1.15-1 (testing)] +233) libxcb-dri3-0 [1.15-1 (testing)] +234) libxcb-glx0 [1.15-1 (testing)] +235) libxcb-present0 [1.15-1 (testing)] +236) libxcb-randr0 [1.15-1 (testing)] +237) libxcb-render0 [1.15-1 (testing)] +238) libxcb-shm0 [1.15-1 (testing)] +239) libxcb-sync1 [1.15-1 (testing)] +240) libxcb-xfixes0 [1.15-1 (testing)] +241) libxcb1 [1.15-1 (testing)] +242) libxcomposite1 [1:0.4.5-1+b1 (testing)] +243) libxcursor1 [1:1.2.1-1+b1 (testing)] +244) libxdamage1 [1:1.1.6-1+b1 (testing)] +245) libxdmcp6 [1:1.1.2-3+b1 (testing)] +246) libxerces2-java [2.12.2-1 (testing)] +247) libxext6 [2:1.3.4-1+b1 (testing)] +248) libxfixes3 [1:6.0.0-2+b1 (testing)] +249) libxi6 [2:1.8.1-1 (testing)] +250) libxinerama1 [2:1.1.4-3+b1 (testing)] +251) libxkbcommon0 [1.6.0-1+b1 (testing)] +252) libxml-commons-external-java [1.4.01-6 (testing)] +253) libxml-commons-resolver1.1-java [1.2-11 (testing)] +254) libxpp3-java [1.1.4c-3 (testing)] +255) libxrandr2 [2:1.5.4-1 (testing)] +256) libxrender1 [1:0.9.10-1.1+b1 (testing)] +257) libxshmfence1 [1.3-1+b1 (testing)] +258) libxstream-java [1.4.20-1 (testing)] +259) libxtst6 [2:1.2.3-1.1+b1 (testing)] +260) libxxf86vm1 [1:1.1.4-1+b2 (testing)] +261) libxz-java [1.9-1 (testing)] +262) libyaml-snake-java [1.33-2 (testing)] +263) libz3-4 [4.8.12-3.1+b2 (testing)] +264) maven-repo-helper [1.11 (testing)] +265) media-types [10.1.0 (testing)] +266) netbase [6.4 (testing)] +267) openjdk-17-jdk [17.0.11+9-1 (testing)] +268) openjdk-17-jdk-headless [17.0.11+9-1 (testing)] +269) openjdk-17-jre [17.0.11+9-1 (testing)] +270) openjdk-17-jre-headless [17.0.11+9-1 (testing)] +271) openssl [3.2.1-3 (testing)] +272) patchutils [0.4.2-1 (testing)] +273) perl-openssl-defaults [7+b2 (testing)] +274) procps [2:4.0.4-4 (testing)] +275) python3 [3.11.8-1 (testing)] +276) python3-minimal [3.11.8-1 (testing)] +277) python3.11 [3.11.9-1 (testing)] +278) python3.11-minimal [3.11.9-1 (testing)] +279) shared-mime-info [2.4-1 (testing)] +280) systemd [255.4-1 (testing)] +281) systemd-dev [255.4-1 (testing)] +282) systemd-sysv [255.4-1 (testing)] +283) testng [6.9.12-4 (testing)] +284) tzdata [2024a-3 (testing)] +285) unzip [6.0-28 (testing)] +286) wdiff [1.2.2-6 (testing)] +287) x11-common [1:7.7+23 (testing)] +288) xfonts-encodings [1:1.0.4-2.2 (testing)] +289) xfonts-utils [1:7.7+6 (testing)] +290) xkb-data [2.41-2 (testing)] The following NEW packages will be installed: - adwaita-icon-theme{a} ant{a} ant-optional{a} antlr{a} at-spi2-common{a} autoconf{a} automake{a} autopoint{a} autotools-dev{a} binfmt-support{a} bnd{a} bsdextrautils{a} ca-certificates{a} ca-certificates-java{a} dbus-broker{a} dbus-session-bus-common{a} dbus-system-bus-common{a} dbus-user-session{a} dconf-gsettings-backend{a} dconf-service{a} dctrl-tools{a} debhelper{a} default-jdk{a} default-jdk-headless{a} default-jre{a} default-jre-headless{a} devscripts{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dirmngr{a} dmsetup{a} dwz{a} fastjar{a} file{a} fontconfig{a} fontconfig-config{a} fonts-urw-base35{a} gettext{a} gettext-base{a} gnupg{a} gnupg-l10n{a} gnupg-utils{a} gpg{a} gpg-agent{a} gpg-wks-client{a} gpg-wks-server{a} gpgconf{a} gpgsm{a} gradle{a} gradle-debian-helper{a} groff-base{a} groovy{a} gtk-update-icon-cache{a} hicolor-icon-theme{a} intltool-debian{a} ivy{a} jarwrapper{a} java-common{a} java-wrappers{a} javahelper{a} junit4{a} libantlr-java{a} libaopalliance-java{a} libapache-pom-java{a} libapparmor1{a} libarchive-zip-perl{a} libargon2-1{a} libasm-java{a} libasound2-data{a} libasound2t64{a} libassuan0{a} libatinject-jsr330-api-java{a} libatk-bridge2.0-0t64{a} libatk1.0-0t64{a} libatspi2.0-0t64{a} libavahi-client3{a} libavahi-common-data{a} libavahi-common3{a} libb-hooks-op-check-perl{a} libbcel-java{a} libbcpg-java{a} libbcprov-java{a} libbrotli1{a} libbsd0{a} libbsf-java{a} libbsh-java{a} libbyte-buddy-java{a} libcairo-gobject2{a} libcairo2{a} libcdi-api-java{a} libclass-method-modifiers-perl{a} libclass-xsaccessor-perl{a} libclone-perl{a} libcloudproviders0{a} libcolord2{a} libcom-err2{a} libcommons-cli-java{a} libcommons-codec-java{a} libcommons-collections3-java{a} libcommons-compress-java{a} libcommons-io-java{a} libcommons-lang-java{a} libcommons-lang3-java{a} libcommons-logging-java{a} libcommons-math3-java{a} libcommons-parent-java{a} libcryptsetup12{a} libcups2t64{a} libdatrie1{a} libdb5.3t64{a} libdbus-1-3{a} libdconf1{a} libdd-plist-java{a} libdebhelper-perl{a} libdeflate0{a} libdevel-callchecker-perl{a} libdevmapper1.02.1{a} libdom4j-java{a} libdrm-amdgpu1{a} libdrm-common{a} libdrm-intel1{a} libdrm-nouveau2{a} libdrm-radeon1{a} libdrm2{a} libdynaloader-functions-perl{a} libeclipse-jdt-annotation-java{a} libedit2{a} libel-api-java{a} libelf1t64{a} libencode-locale-perl{a} libepoxy0{a} liberror-prone-java{a} libexpat1{a} libfdisk1{a} libfelix-framework-java{a} libfelix-gogo-runtime-java{a} libfelix-resolver-java{a} libfile-dirlist-perl{a} libfile-homedir-perl{a} libfile-listing-perl{a} libfile-stripnondeterminism-perl{a} libfile-touch-perl{a} libfile-which-perl{a} libfindbugs-java{a} libfontconfig1{a} libfontenc1{a} libfreetype6{a} libfribidi0{a} libgdk-pixbuf-2.0-0{a} libgdk-pixbuf2.0-common{a} libgeronimo-annotation-1.3-spec-java{a} libgeronimo-interceptor-3.0-spec-java{a} libgif7{a} libgl1{a} libgl1-mesa-dri{a} libglapi-mesa{a} libglib2.0-0t64{a} libglvnd0{a} libglx-mesa0{a} libglx0{a} libgoogle-gson-java{a} libgradle-core-java{a} libgradle-plugins-java{a} libgraphite2-3{a} libgssapi-krb5-2{a} libgtk-3-0t64{a} libgtk-3-common{a} libguava-java{a} libguice-java{a} libhamcrest-java{a} libharfbuzz0b{a} libhawtjni-runtime-java{a} libhtml-parser-perl{a} libhtml-tagset-perl{a} libhtml-tree-perl{a} libhttp-cookies-perl{a} libhttp-date-perl{a} libhttp-message-perl{a} libhttp-negotiate-perl{a} libhttpclient-java{a} libhttpcore-java{a} libicu72{a} libimport-into-perl{a} libio-html-perl{a} libio-pty-perl{a} libio-socket-ssl-perl{a} libipc-run-perl{a} libjackson2-annotations-java{a} libjackson2-core-java{a} libjackson2-databind-java{a} libjansi-java{a} libjansi-native-java{a} libjansi1-java{a} libjarjar-java{a} libjatl-java{a} libjavaewah-java{a} libjaxen-java{a} libjbig0{a} libjcifs-java{a} libjcip-annotations-java{a} libjcommander-java{a} libjetty9-java{a} libjformatstring-java{a} libjgit-java{a} libjline2-java{a} libjna-java{a} libjna-jni{a} libjpeg62-turbo{a} libjs-jquery{a} libjsch-java{a} libjson-c5{a} libjsoup-java{a} libjsp-api-java{a} libjsr305-java{a} libjzlib-java{a} libk5crypto3{a} libkeyutils1{a} libkmod2{a} libkrb5-3{a} libkrb5support0{a} libkryo-java{a} libksba8{a} liblcms2-2{a} libldap-2.5-0{a} liblerc4{a} libllvm17t64{a} liblogback-java{a} liblwp-mediatypes-perl{a} liblwp-protocol-https-perl{a} liblz4-java{a} liblz4-jni{a} libmagic-mgc{a} libmagic1t64{a} libmaven-parent-java{a} libmaven-resolver-java{a} libmaven-shared-utils-java{a} libmaven3-core-java{a} libminlog-java{a} libmockito-java{a} libmodule-runtime-perl{a} libmoo-perl{a} libnative-platform-java{a} libnative-platform-jni{a} libnekohtml-java{a} libnet-http-perl{a} libnet-ssleay-perl{a} libnpth0t64{a} libnspr4{a} libnss3{a} libobjenesis-java{a} libosgi-annotation-java{a} libosgi-compendium-java{a} libosgi-core-java{a} libpam-systemd{a} libpango-1.0-0{a} libpangocairo-1.0-0{a} libpangoft2-1.0-0{a} libparams-classify-perl{a} libpciaccess0{a} libpcsclite1{a} libpipeline1{a} libpixman-1-0{a} libplexus-cipher-java{a} libplexus-classworlds-java{a} libplexus-component-annotations-java{a} libplexus-container-default-java{a} libplexus-interpolation-java{a} libplexus-sec-dispatcher-java{a} libplexus-utils2-java{a} libpng16-16t64{a} libpolyglot-maven-java{a} libproc2-0{a} libpython3-stdlib{a} libpython3.11-minimal{a} libpython3.11-stdlib{a} libqdox-java{a} libreadline8t64{a} libredberry-pipe-java{a} libreflectasm-java{a} librhino-java{a} librole-tiny-perl{a} libsasl2-2{a} libsasl2-modules-db{a} libsensors-config{a} libsensors5{a} libservlet-api-java{a} libsharpyuv0{a} libsimple-http-java{a} libsisu-inject-java{a} libsisu-plexus-java{a} libslf4j-java{a} libssl3t64{a} libsub-override-perl{a} libsub-quote-perl{a} libsystemd-shared{a} libthai-data{a} libthai0{a} libtiff6{a} libtimedate-perl{a} libtool{a} libtrove3-java{a} libtry-tiny-perl{a} libuchardet0{a} liburi-perl{a} libvulkan1{a} libwagon-file-java{a} libwagon-http-java{a} libwagon-provider-api-java{a} libwayland-client0{a} libwayland-cursor0{a} libwayland-egl1{a} libwebp7{a} libwebsocket-api-java{a} libwww-perl{a} libwww-robotrules-perl{a} libx11-6{a} libx11-data{a} libx11-xcb1{a} libxau6{a} libxbean-reflect-java{a} libxcb-dri2-0{a} libxcb-dri3-0{a} libxcb-glx0{a} libxcb-present0{a} libxcb-randr0{a} libxcb-render0{a} libxcb-shm0{a} libxcb-sync1{a} libxcb-xfixes0{a} libxcb1{a} libxcomposite1{a} libxcursor1{a} libxdamage1{a} libxdmcp6{a} libxerces2-java{a} libxext6{a} libxfixes3{a} libxi6{a} libxinerama1{a} libxkbcommon0{a} libxml-commons-external-java{a} libxml-commons-resolver1.1-java{a} libxml2{a} libxpp3-java{a} libxrandr2{a} libxrender1{a} libxshmfence1{a} libxstream-java{a} libxtst6{a} libxxf86vm1{a} libxz-java{a} libyaml-snake-java{a} libz3-4{a} m4{a} man-db{a} maven-repo-helper{a} media-types{a} netbase{a} openjdk-17-jdk{a} openjdk-17-jdk-headless{a} openjdk-17-jre{a} openjdk-17-jre-headless{a} openssl{a} patchutils{a} perl-openssl-defaults{a} pinentry-curses{a} po-debconf{a} procps{a} python3{a} python3-minimal{a} python3.11{a} python3.11-minimal{a} readline-common{a} sensible-utils{a} shared-mime-info{a} systemd{a} systemd-dev{a} systemd-sysv{a} testng{a} tzdata{a} unzip{a} wdiff{a} x11-common{a} xfonts-encodings{a} xfonts-utils{a} xkb-data{a} + adwaita-icon-theme{a} ant{a} ant-optional{a} antlr{a} at-spi2-common{a} autoconf{a} automake{a} autopoint{a} autotools-dev{a} binfmt-support{a} bnd{a} bsdextrautils{a} ca-certificates{a} ca-certificates-java{a} dbus-broker{a} dbus-session-bus-common{a} dbus-system-bus-common{a} dbus-user-session{a} dconf-gsettings-backend{a} dconf-service{a} dctrl-tools{a} debhelper{a} default-jdk{a} default-jdk-headless{a} default-jre{a} default-jre-headless{a} devscripts{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dirmngr{a} dmsetup{a} dwz{a} fastjar{a} file{a} fontconfig{a} fontconfig-config{a} fonts-urw-base35{a} gettext{a} gettext-base{a} gnupg{a} gnupg-l10n{a} gnupg-utils{a} gpg{a} gpg-agent{a} gpg-wks-client{a} gpg-wks-server{a} gpgconf{a} gpgsm{a} gradle{a} gradle-debian-helper{a} groff-base{a} groovy{a} gtk-update-icon-cache{a} hicolor-icon-theme{a} intltool-debian{a} ivy{a} jarwrapper{a} java-common{a} java-wrappers{a} javahelper{a} junit4{a} libantlr-java{a} libaopalliance-java{a} libapache-pom-java{a} libapparmor1{a} libarchive-zip-perl{a} libargon2-1{a} libasm-java{a} libasound2-data{a} libasound2t64{a} libassuan0{a} libatinject-jsr330-api-java{a} libatk-bridge2.0-0t64{a} libatk1.0-0t64{a} libatspi2.0-0t64{a} libavahi-client3{a} libavahi-common-data{a} libavahi-common3{a} libb-hooks-op-check-perl{a} libbcel-java{a} libbcpg-java{a} libbcprov-java{a} libbrotli1{a} libbsd0{a} libbsf-java{a} libbsh-java{a} libbyte-buddy-java{a} libcairo-gobject2{a} libcairo2{a} libcdi-api-java{a} libclass-method-modifiers-perl{a} libclass-xsaccessor-perl{a} libclone-perl{a} libcloudproviders0{a} libcolord2{a} libcommons-cli-java{a} libcommons-codec-java{a} libcommons-collections3-java{a} libcommons-compress-java{a} libcommons-io-java{a} libcommons-lang-java{a} libcommons-lang3-java{a} libcommons-logging-java{a} libcommons-math3-java{a} libcommons-parent-java{a} libcryptsetup12{a} libcups2t64{a} libdatrie1{a} libdb5.3t64{a} libdbus-1-3{a} libdconf1{a} libdd-plist-java{a} libdebhelper-perl{a} libdeflate0{a} libdevel-callchecker-perl{a} libdevmapper1.02.1{a} libdom4j-java{a} libdrm-amdgpu1{a} libdrm-common{a} libdrm-intel1{a} libdrm-nouveau2{a} libdrm-radeon1{a} libdrm2{a} libdynaloader-functions-perl{a} libeclipse-jdt-annotation-java{a} libedit2{a} libel-api-java{a} libelf1t64{a} libencode-locale-perl{a} libepoxy0{a} liberror-prone-java{a} libexpat1{a} libfdisk1{a} libfelix-framework-java{a} libfelix-gogo-runtime-java{a} libfelix-resolver-java{a} libfile-dirlist-perl{a} libfile-homedir-perl{a} libfile-listing-perl{a} libfile-stripnondeterminism-perl{a} libfile-touch-perl{a} libfile-which-perl{a} libfindbugs-java{a} libfontconfig1{a} libfontenc1{a} libfreetype6{a} libfribidi0{a} libgdk-pixbuf-2.0-0{a} libgdk-pixbuf2.0-common{a} libgeronimo-annotation-1.3-spec-java{a} libgeronimo-interceptor-3.0-spec-java{a} libgif7{a} libgl1{a} libgl1-mesa-dri{a} libglapi-mesa{a} libglib2.0-0t64{a} libglvnd0{a} libglx-mesa0{a} libglx0{a} libgoogle-gson-java{a} libgradle-core-java{a} libgradle-plugins-java{a} libgraphite2-3{a} libgtk-3-0t64{a} libgtk-3-common{a} libguava-java{a} libguice-java{a} libhamcrest-java{a} libharfbuzz0b{a} libhawtjni-runtime-java{a} libhtml-parser-perl{a} libhtml-tagset-perl{a} libhtml-tree-perl{a} libhttp-cookies-perl{a} libhttp-date-perl{a} libhttp-message-perl{a} libhttp-negotiate-perl{a} libhttpclient-java{a} libhttpcore-java{a} libicu72{a} libimport-into-perl{a} libio-html-perl{a} libio-pty-perl{a} libio-socket-ssl-perl{a} libipc-run-perl{a} libjackson2-annotations-java{a} libjackson2-core-java{a} libjackson2-databind-java{a} libjansi-java{a} libjansi-native-java{a} libjansi1-java{a} libjarjar-java{a} libjatl-java{a} libjavaewah-java{a} libjaxen-java{a} libjbig0{a} libjcifs-java{a} libjcip-annotations-java{a} libjcommander-java{a} libjetty9-java{a} libjformatstring-java{a} libjgit-java{a} libjline2-java{a} libjna-java{a} libjna-jni{a} libjpeg62-turbo{a} libjs-jquery{a} libjsch-java{a} libjson-c5{a} libjsoup-java{a} libjsp-api-java{a} libjsr305-java{a} libjzlib-java{a} libkmod2{a} libkryo-java{a} libksba8{a} liblcms2-2{a} libldap-2.5-0{a} liblerc4{a} libllvm17t64{a} liblogback-java{a} liblwp-mediatypes-perl{a} liblwp-protocol-https-perl{a} liblz4-java{a} liblz4-jni{a} libmagic-mgc{a} libmagic1t64{a} libmaven-parent-java{a} libmaven-resolver-java{a} libmaven-shared-utils-java{a} libmaven3-core-java{a} libminlog-java{a} libmockito-java{a} libmodule-runtime-perl{a} libmoo-perl{a} libnative-platform-java{a} libnative-platform-jni{a} libnekohtml-java{a} libnet-http-perl{a} libnet-ssleay-perl{a} libnpth0t64{a} libnspr4{a} libnss3{a} libobjenesis-java{a} libosgi-annotation-java{a} libosgi-compendium-java{a} libosgi-core-java{a} libpam-systemd{a} libpango-1.0-0{a} libpangocairo-1.0-0{a} libpangoft2-1.0-0{a} libparams-classify-perl{a} libpciaccess0{a} libpcsclite1{a} libpipeline1{a} libpixman-1-0{a} libplexus-cipher-java{a} libplexus-classworlds-java{a} libplexus-component-annotations-java{a} libplexus-container-default-java{a} libplexus-interpolation-java{a} libplexus-sec-dispatcher-java{a} libplexus-utils2-java{a} libpng16-16t64{a} libpolyglot-maven-java{a} libproc2-0{a} libpython3-stdlib{a} libpython3.11-minimal{a} libpython3.11-stdlib{a} libqdox-java{a} libreadline8t64{a} libredberry-pipe-java{a} libreflectasm-java{a} librhino-java{a} librole-tiny-perl{a} libsasl2-2{a} libsasl2-modules-db{a} libsensors-config{a} libsensors5{a} libservlet-api-java{a} libsharpyuv0{a} libsimple-http-java{a} libsisu-inject-java{a} libsisu-plexus-java{a} libslf4j-java{a} libssl3t64{a} libsub-override-perl{a} libsub-quote-perl{a} libsystemd-shared{a} libthai-data{a} libthai0{a} libtiff6{a} libtimedate-perl{a} libtool{a} libtrove3-java{a} libtry-tiny-perl{a} libuchardet0{a} liburi-perl{a} libvulkan1{a} libwagon-file-java{a} libwagon-http-java{a} libwagon-provider-api-java{a} libwayland-client0{a} libwayland-cursor0{a} libwayland-egl1{a} libwebp7{a} libwebsocket-api-java{a} libwww-perl{a} libwww-robotrules-perl{a} libx11-6{a} libx11-data{a} libx11-xcb1{a} libxau6{a} libxbean-reflect-java{a} libxcb-dri2-0{a} libxcb-dri3-0{a} libxcb-glx0{a} libxcb-present0{a} libxcb-randr0{a} libxcb-render0{a} libxcb-shm0{a} libxcb-sync1{a} libxcb-xfixes0{a} libxcb1{a} libxcomposite1{a} libxcursor1{a} libxdamage1{a} libxdmcp6{a} libxerces2-java{a} libxext6{a} libxfixes3{a} libxi6{a} libxinerama1{a} libxkbcommon0{a} libxml-commons-external-java{a} libxml-commons-resolver1.1-java{a} libxml2{a} libxpp3-java{a} libxrandr2{a} libxrender1{a} libxshmfence1{a} libxstream-java{a} libxtst6{a} libxxf86vm1{a} libxz-java{a} libyaml-snake-java{a} libz3-4{a} m4{a} man-db{a} maven-repo-helper{a} media-types{a} netbase{a} openjdk-17-jdk{a} openjdk-17-jdk-headless{a} openjdk-17-jre{a} openjdk-17-jre-headless{a} openssl{a} patchutils{a} perl-openssl-defaults{a} pinentry-curses{a} po-debconf{a} procps{a} python3{a} python3-minimal{a} python3.11{a} python3.11-minimal{a} readline-common{a} sensible-utils{a} shared-mime-info{a} systemd{a} systemd-dev{a} systemd-sysv{a} testng{a} tzdata{a} unzip{a} wdiff{a} x11-common{a} xfonts-encodings{a} xfonts-utils{a} xkb-data{a} The following packages will be REMOVED: libdb5.3{a} libssl3{a} The following packages are RECOMMENDED but will NOT be installed: - alsa-topology-conf alsa-ucm-conf at-spi2-core chrony curl dbus dbus-bin debian-keyring dput dput-ng dupload equivs fonts-dejavu-extra javascript-common krb5-locales libarchive-cpio-perl libatk-wrapper-java-jni libbindex-java libdata-dump-perl libdistro-info-perl libgdk-pixbuf2.0-bin libgit-wrapper-perl libgitlab-api-v4-perl libglib2.0-data libgpars-groovy-java libgtk-3-bin libhtml-form-perl libhtml-format-perl libhttp-daemon-perl libio-compress-brotli-perl libjson-perl libldap-common liblist-compare-perl libltdl-dev libmail-sendmail-perl libmailtools-perl libnamespace-clean-perl libnss-systemd libreflectasm-java-doc librsvg2-common libsasl2-modules libsoap-lite-perl libstring-shellquote-perl libxstring-perl libxt-dev licensecheck lintian lynx mesa-vulkan-drivers ntpsec openntpd pristine-tar psmisc python3-apt python3-debian python3-magic python3-requests python3-unidiff python3-xdg strace systemd-timesyncd wget xdg-user-dirs -0 packages upgraded, 386 newly installed, 2 to remove and 0 not upgraded. -Need to get 341 MB of archives. After unpacking 888 MB will be used. + alsa-topology-conf alsa-ucm-conf at-spi2-core chrony curl dbus dbus-bin debian-keyring dput dput-ng dupload equivs fonts-dejavu-extra javascript-common libarchive-cpio-perl libatk-wrapper-java-jni libbindex-java libdata-dump-perl libdistro-info-perl libgdk-pixbuf2.0-bin libgit-wrapper-perl libgitlab-api-v4-perl libglib2.0-data libgpars-groovy-java libgtk-3-bin libhtml-form-perl libhtml-format-perl libhttp-daemon-perl libio-compress-brotli-perl libjson-perl libldap-common liblist-compare-perl libltdl-dev libmail-sendmail-perl libmailtools-perl libnamespace-clean-perl libnss-systemd libreflectasm-java-doc librsvg2-common libsasl2-modules libsoap-lite-perl libstring-shellquote-perl libxstring-perl libxt-dev licensecheck lintian lynx mesa-vulkan-drivers ntpsec openntpd pristine-tar psmisc python3-apt python3-debian python3-magic python3-requests python3-unidiff python3-xdg strace systemd-timesyncd wget xdg-user-dirs +0 packages upgraded, 380 newly installed, 2 to remove and 0 not upgraded. +Need to get 341 MB of archives. After unpacking 886 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian trixie/main i386 libdb5.3t64 i386 5.3.28+dfsg2-7 [759 kB] Get: 2 http://deb.debian.org/debian trixie/main i386 libssl3t64 i386 3.2.1-3 [2234 kB] @@ -615,268 +641,263 @@ Get: 147 http://deb.debian.org/debian trixie/main i386 libavahi-common-data i386 0.8-13+b2 [112 kB] Get: 148 http://deb.debian.org/debian trixie/main i386 libavahi-common3 i386 0.8-13+b2 [45.3 kB] Get: 149 http://deb.debian.org/debian trixie/main i386 libavahi-client3 i386 0.8-13+b2 [49.3 kB] -Get: 150 http://deb.debian.org/debian trixie/main i386 libkrb5support0 i386 1.20.1-5+b1 [35.9 kB] -Get: 151 http://deb.debian.org/debian trixie/main i386 libcom-err2 i386 1.47.0-2.4 [20.6 kB] -Get: 152 http://deb.debian.org/debian trixie/main i386 libk5crypto3 i386 1.20.1-5+b1 [83.2 kB] -Get: 153 http://deb.debian.org/debian trixie/main i386 libkeyutils1 i386 1.6.3-3 [9432 B] -Get: 154 http://deb.debian.org/debian trixie/main i386 libkrb5-3 i386 1.20.1-5+b1 [359 kB] -Get: 155 http://deb.debian.org/debian trixie/main i386 libgssapi-krb5-2 i386 1.20.1-5+b1 [145 kB] -Get: 156 http://deb.debian.org/debian trixie/main i386 libcups2t64 i386 2.4.7-1.2+b1 [264 kB] -Get: 157 http://deb.debian.org/debian trixie/main i386 libepoxy0 i386 1.5.10-1+b2 [196 kB] -Get: 158 http://deb.debian.org/debian trixie/main i386 libfribidi0 i386 1.0.13-3+b1 [71.8 kB] -Get: 159 http://deb.debian.org/debian trixie/main i386 libgraphite2-3 i386 1.3.14-2 [77.7 kB] -Get: 160 http://deb.debian.org/debian trixie/main i386 libharfbuzz0b i386 8.3.0-2+b1 [2234 kB] -Get: 161 http://deb.debian.org/debian trixie/main i386 fontconfig i386 2.15.0-1.1 [462 kB] -Get: 162 http://deb.debian.org/debian trixie/main i386 libthai-data all 0.1.29-2 [168 kB] -Get: 163 http://deb.debian.org/debian trixie/main i386 libdatrie1 i386 0.2.13-3 [39.5 kB] -Get: 164 http://deb.debian.org/debian trixie/main i386 libthai0 i386 0.1.29-2 [50.1 kB] -Get: 165 http://deb.debian.org/debian trixie/main i386 libpango-1.0-0 i386 1.52.1+ds-1 [224 kB] -Get: 166 http://deb.debian.org/debian trixie/main i386 libpangoft2-1.0-0 i386 1.52.1+ds-1 [51.1 kB] -Get: 167 http://deb.debian.org/debian trixie/main i386 libpangocairo-1.0-0 i386 1.52.1+ds-1 [36.0 kB] -Get: 168 http://deb.debian.org/debian trixie/main i386 libwayland-client0 i386 1.22.0-2.1+b1 [26.4 kB] -Get: 169 http://deb.debian.org/debian trixie/main i386 libwayland-cursor0 i386 1.22.0-2.1+b1 [12.0 kB] -Get: 170 http://deb.debian.org/debian trixie/main i386 libwayland-egl1 i386 1.22.0-2.1+b1 [5712 B] -Get: 171 http://deb.debian.org/debian trixie/main i386 libxcomposite1 i386 1:0.4.5-1+b1 [15.2 kB] -Get: 172 http://deb.debian.org/debian trixie/main i386 libxfixes3 i386 1:6.0.0-2+b1 [20.7 kB] -Get: 173 http://deb.debian.org/debian trixie/main i386 libxcursor1 i386 1:1.2.1-1+b1 [37.6 kB] -Get: 174 http://deb.debian.org/debian trixie/main i386 libxdamage1 i386 1:1.1.6-1+b1 [15.6 kB] -Get: 175 http://deb.debian.org/debian trixie/main i386 libxinerama1 i386 2:1.1.4-3+b1 [16.3 kB] -Get: 176 http://deb.debian.org/debian trixie/main i386 xkb-data all 2.41-2 [795 kB] -Get: 177 http://deb.debian.org/debian trixie/main i386 libxkbcommon0 i386 1.6.0-1+b1 [115 kB] -Get: 178 http://deb.debian.org/debian trixie/main i386 libxrandr2 i386 2:1.5.4-1 [37.7 kB] -Get: 179 http://deb.debian.org/debian trixie/main i386 libgtk-3-common all 3.24.41-4 [4635 kB] -Get: 180 http://deb.debian.org/debian trixie/main i386 libgtk-3-0t64 i386 3.24.41-4 [2897 kB] -Get: 181 http://deb.debian.org/debian trixie/main i386 libglvnd0 i386 1.7.0-1+b1 [44.4 kB] -Get: 182 http://deb.debian.org/debian trixie/main i386 libdrm-common all 2.4.120-2 [7688 B] -Get: 183 http://deb.debian.org/debian trixie/main i386 libdrm2 i386 2.4.120-2 [41.4 kB] -Get: 184 http://deb.debian.org/debian trixie/main i386 libglapi-mesa i386 23.3.5-1 [35.4 kB] -Get: 185 http://deb.debian.org/debian trixie/main i386 libx11-xcb1 i386 2:1.8.7-1+b1 [232 kB] -Get: 186 http://deb.debian.org/debian trixie/main i386 libxcb-dri2-0 i386 1.15-1 [107 kB] -Get: 187 http://deb.debian.org/debian trixie/main i386 libxcb-dri3-0 i386 1.15-1 [107 kB] -Get: 188 http://deb.debian.org/debian trixie/main i386 libxcb-glx0 i386 1.15-1 [124 kB] -Get: 189 http://deb.debian.org/debian trixie/main i386 libxcb-present0 i386 1.15-1 [106 kB] -Get: 190 http://deb.debian.org/debian trixie/main i386 libxcb-randr0 i386 1.15-1 [118 kB] -Get: 191 http://deb.debian.org/debian trixie/main i386 libxcb-sync1 i386 1.15-1 [109 kB] -Get: 192 http://deb.debian.org/debian trixie/main i386 libxcb-xfixes0 i386 1.15-1 [110 kB] -Get: 193 http://deb.debian.org/debian trixie/main i386 libxshmfence1 i386 1.3-1+b1 [9028 B] -Get: 194 http://deb.debian.org/debian trixie/main i386 libxxf86vm1 i386 1:1.1.4-1+b2 [21.7 kB] -Get: 195 http://deb.debian.org/debian trixie/main i386 libvulkan1 i386 1.3.280.0-1 [132 kB] -Get: 196 http://deb.debian.org/debian trixie/main i386 libdrm-amdgpu1 i386 2.4.120-2 [24.4 kB] -Get: 197 http://deb.debian.org/debian trixie/main i386 libpciaccess0 i386 0.17-3+b1 [53.8 kB] -Get: 198 http://deb.debian.org/debian trixie/main i386 libdrm-intel1 i386 2.4.120-2 [66.5 kB] -Get: 199 http://deb.debian.org/debian trixie/main i386 libdrm-nouveau2 i386 2.4.120-2 [20.8 kB] -Get: 200 http://deb.debian.org/debian trixie/main i386 libdrm-radeon1 i386 2.4.120-2 [23.0 kB] -Get: 201 http://deb.debian.org/debian trixie/main i386 libedit2 i386 3.1-20230828-1+b1 [97.8 kB] -Get: 202 http://deb.debian.org/debian trixie/main i386 libz3-4 i386 4.8.12-3.1+b2 [7989 kB] -Get: 203 http://deb.debian.org/debian trixie/main i386 libllvm17t64 i386 1:17.0.6-11 [27.7 MB] -Get: 204 http://deb.debian.org/debian trixie/main i386 libsensors-config all 1:3.6.0-9 [14.6 kB] -Get: 205 http://deb.debian.org/debian trixie/main i386 libsensors5 i386 1:3.6.0-9 [35.4 kB] -Get: 206 http://deb.debian.org/debian trixie/main i386 libgl1-mesa-dri i386 23.3.5-1 [8327 kB] -Get: 207 http://deb.debian.org/debian trixie/main i386 libglx-mesa0 i386 23.3.5-1 [157 kB] -Get: 208 http://deb.debian.org/debian trixie/main i386 libglx0 i386 1.7.0-1+b1 [38.0 kB] -Get: 209 http://deb.debian.org/debian trixie/main i386 libgl1 i386 1.7.0-1+b1 [82.7 kB] -Get: 210 http://deb.debian.org/debian trixie/main i386 libasound2-data all 1.2.11-1 [20.9 kB] -Get: 211 http://deb.debian.org/debian trixie/main i386 libasound2t64 i386 1.2.11-1+b1 [395 kB] -Get: 212 http://deb.debian.org/debian trixie/main i386 libgif7 i386 5.2.2-1 [45.3 kB] -Get: 213 http://deb.debian.org/debian trixie/main i386 libxtst6 i386 2:1.2.3-1.1+b1 [26.5 kB] -Get: 214 http://deb.debian.org/debian trixie/main i386 openjdk-17-jre i386 17.0.11+9-1 [184 kB] -Get: 215 http://deb.debian.org/debian trixie/main i386 default-jre i386 2:1.17-75 [1056 B] -Get: 216 http://deb.debian.org/debian trixie/main i386 openjdk-17-jdk-headless i386 17.0.11+9-1 [74.0 MB] -Get: 217 http://deb.debian.org/debian trixie/main i386 default-jdk-headless i386 2:1.17-75 [1108 B] -Get: 218 http://deb.debian.org/debian trixie/main i386 openjdk-17-jdk i386 17.0.11+9-1 [10.4 kB] -Get: 219 http://deb.debian.org/debian trixie/main i386 default-jdk i386 2:1.17-75 [1068 B] -Get: 220 http://deb.debian.org/debian trixie/main i386 libassuan0 i386 2.5.6-1+b1 [52.2 kB] -Get: 221 http://deb.debian.org/debian trixie/main i386 gpgconf i386 2.2.40-1.1+b1 [572 kB] -Get: 222 http://deb.debian.org/debian trixie/main i386 libksba8 i386 1.6.6-1 [138 kB] -Get: 223 http://deb.debian.org/debian trixie/main i386 libsasl2-modules-db i386 2.1.28+dfsg1-4+b1 [20.7 kB] -Get: 224 http://deb.debian.org/debian trixie/main i386 libsasl2-2 i386 2.1.28+dfsg1-4+b1 [60.7 kB] -Get: 225 http://deb.debian.org/debian trixie/main i386 libldap-2.5-0 i386 2.5.13+dfsg-5+b3 [196 kB] -Get: 226 http://deb.debian.org/debian trixie/main i386 libnpth0t64 i386 1.6-3.1 [18.0 kB] -Get: 227 http://deb.debian.org/debian trixie/main i386 dirmngr i386 2.2.40-1.1+b1 [820 kB] -Get: 228 http://deb.debian.org/debian trixie/main i386 gnupg-l10n all 2.2.40-1.1 [1093 kB] -Get: 229 http://deb.debian.org/debian trixie/main i386 gnupg-utils i386 2.2.40-1.1+b1 [973 kB] -Get: 230 http://deb.debian.org/debian trixie/main i386 gpg i386 2.2.40-1.1+b1 [991 kB] -Get: 231 http://deb.debian.org/debian trixie/main i386 pinentry-curses i386 1.2.1-3 [79.4 kB] -Get: 232 http://deb.debian.org/debian trixie/main i386 gpg-agent i386 2.2.40-1.1+b1 [716 kB] -Get: 233 http://deb.debian.org/debian trixie/main i386 gpg-wks-client i386 2.2.40-1.1+b1 [551 kB] -Get: 234 http://deb.debian.org/debian trixie/main i386 gpg-wks-server i386 2.2.40-1.1+b1 [541 kB] -Get: 235 http://deb.debian.org/debian trixie/main i386 gpgsm i386 2.2.40-1.1+b1 [691 kB] -Get: 236 http://deb.debian.org/debian trixie/main i386 gnupg all 2.2.40-1.1 [846 kB] -Get: 237 http://deb.debian.org/debian trixie/main i386 libfile-dirlist-perl all 0.05-3 [7600 B] -Get: 238 http://deb.debian.org/debian trixie/main i386 libfile-which-perl all 1.27-2 [15.1 kB] -Get: 239 http://deb.debian.org/debian trixie/main i386 libfile-homedir-perl all 1.006-2 [42.4 kB] -Get: 240 http://deb.debian.org/debian trixie/main i386 libfile-touch-perl all 0.12-2 [8816 B] -Get: 241 http://deb.debian.org/debian trixie/main i386 libio-pty-perl i386 1:1.20-1 [35.7 kB] -Get: 242 http://deb.debian.org/debian trixie/main i386 libipc-run-perl all 20231003.0-2 [101 kB] -Get: 243 http://deb.debian.org/debian trixie/main i386 libclass-method-modifiers-perl all 2.15-1 [18.0 kB] -Get: 244 http://deb.debian.org/debian trixie/main i386 libclass-xsaccessor-perl i386 1.19-4+b2 [37.7 kB] -Get: 245 http://deb.debian.org/debian trixie/main i386 libb-hooks-op-check-perl i386 0.22-2+b2 [10.7 kB] -Get: 246 http://deb.debian.org/debian trixie/main i386 libdynaloader-functions-perl all 0.003-3 [12.7 kB] -Get: 247 http://deb.debian.org/debian trixie/main i386 libdevel-callchecker-perl i386 0.008-2+b1 [15.1 kB] -Get: 248 http://deb.debian.org/debian trixie/main i386 libparams-classify-perl i386 0.015-2+b2 [23.1 kB] -Get: 249 http://deb.debian.org/debian trixie/main i386 libmodule-runtime-perl all 0.016-2 [19.6 kB] -Get: 250 http://deb.debian.org/debian trixie/main i386 libimport-into-perl all 1.002005-2 [11.3 kB] -Get: 251 http://deb.debian.org/debian trixie/main i386 librole-tiny-perl all 2.002004-1 [21.4 kB] -Get: 252 http://deb.debian.org/debian trixie/main i386 libsub-quote-perl all 2.006008-1 [21.8 kB] -Get: 253 http://deb.debian.org/debian trixie/main i386 libmoo-perl all 2.005005-1 [58.0 kB] -Get: 254 http://deb.debian.org/debian trixie/main i386 libencode-locale-perl all 1.05-3 [12.9 kB] -Get: 255 http://deb.debian.org/debian trixie/main i386 libtimedate-perl all 2.3300-2 [39.3 kB] -Get: 256 http://deb.debian.org/debian trixie/main i386 libhttp-date-perl all 6.06-1 [10.7 kB] -Get: 257 http://deb.debian.org/debian trixie/main i386 libfile-listing-perl all 6.16-1 [12.4 kB] -Get: 258 http://deb.debian.org/debian trixie/main i386 libhtml-tagset-perl all 3.24-1 [14.7 kB] -Get: 259 http://deb.debian.org/debian trixie/main i386 liburi-perl all 5.28-1 [98.6 kB] -Get: 260 http://deb.debian.org/debian trixie/main i386 libhtml-parser-perl i386 3.81-1+b1 [100 kB] -Get: 261 http://deb.debian.org/debian trixie/main i386 libhtml-tree-perl all 5.07-3 [211 kB] -Get: 262 http://deb.debian.org/debian trixie/main i386 libclone-perl i386 0.46-1+b1 [13.9 kB] -Get: 263 http://deb.debian.org/debian trixie/main i386 libio-html-perl all 1.004-3 [16.2 kB] -Get: 264 http://deb.debian.org/debian trixie/main i386 liblwp-mediatypes-perl all 6.04-2 [20.2 kB] -Get: 265 http://deb.debian.org/debian trixie/main i386 libhttp-message-perl all 6.45-1 [82.0 kB] -Get: 266 http://deb.debian.org/debian trixie/main i386 libhttp-cookies-perl all 6.11-1 [19.1 kB] -Get: 267 http://deb.debian.org/debian trixie/main i386 libhttp-negotiate-perl all 6.01-2 [13.1 kB] -Get: 268 http://deb.debian.org/debian trixie/main i386 perl-openssl-defaults i386 7+b2 [6720 B] -Get: 269 http://deb.debian.org/debian trixie/main i386 libnet-ssleay-perl i386 1.94-1 [339 kB] -Get: 270 http://deb.debian.org/debian trixie/main i386 libio-socket-ssl-perl all 2.085-1 [218 kB] -Get: 271 http://deb.debian.org/debian trixie/main i386 libnet-http-perl all 6.23-1 [23.9 kB] -Get: 272 http://deb.debian.org/debian trixie/main i386 liblwp-protocol-https-perl all 6.14-1 [10.8 kB] -Get: 273 http://deb.debian.org/debian trixie/main i386 libtry-tiny-perl all 0.31-2 [22.6 kB] -Get: 274 http://deb.debian.org/debian trixie/main i386 libwww-robotrules-perl all 6.02-1 [12.9 kB] -Get: 275 http://deb.debian.org/debian trixie/main i386 libwww-perl all 6.77-1 [183 kB] -Get: 276 http://deb.debian.org/debian trixie/main i386 patchutils i386 0.4.2-1 [79.6 kB] -Get: 277 http://deb.debian.org/debian trixie/main i386 wdiff i386 1.2.2-6 [120 kB] -Get: 278 http://deb.debian.org/debian trixie/main i386 devscripts all 2.23.7 [1068 kB] -Get: 279 http://deb.debian.org/debian trixie/main i386 fastjar i386 2:0.98-7 [47.3 kB] -Get: 280 http://deb.debian.org/debian trixie/main i386 ivy all 2.5.2-1 [1295 kB] -Get: 281 http://deb.debian.org/debian trixie/main i386 libasm-java all 9.7-1 [394 kB] -Get: 282 http://deb.debian.org/debian trixie/main i386 libbsf-java all 1:2.4.0-8 [76.3 kB] -Get: 283 http://deb.debian.org/debian trixie/main i386 libcommons-cli-java all 1.6.0-1 [60.4 kB] -Get: 284 http://deb.debian.org/debian trixie/main i386 libapache-pom-java all 29-2 [5276 B] -Get: 285 http://deb.debian.org/debian trixie/main i386 libcommons-parent-java all 56-1 [10.8 kB] -Get: 286 http://deb.debian.org/debian trixie/main i386 libcommons-logging-java all 1.3.0-1 [68.6 kB] -Get: 287 http://deb.debian.org/debian trixie/main i386 libjansi-java all 2.4.1-2 [100 kB] -Get: 288 http://deb.debian.org/debian trixie/main i386 libjsp-api-java all 2.3.4-3 [53.7 kB] -Get: 289 http://deb.debian.org/debian trixie/main i386 libqdox-java all 1.12.1-3 [172 kB] -Get: 290 http://deb.debian.org/debian trixie/main i386 libservlet-api-java all 4.0.1-2 [81.0 kB] -Get: 291 http://deb.debian.org/debian trixie/main i386 libxpp3-java all 1.1.4c-3 [292 kB] -Get: 292 http://deb.debian.org/debian trixie/main i386 libxstream-java all 1.4.20-1 [565 kB] -Get: 293 http://deb.debian.org/debian trixie/main i386 groovy all 2.4.21-10 [12.8 MB] -Get: 294 http://deb.debian.org/debian trixie/main i386 libatinject-jsr330-api-java all 1.0+ds1-5 [5312 B] -Get: 295 http://deb.debian.org/debian trixie/main i386 libcommons-collections3-java all 3.2.2-3 [530 kB] -Get: 296 http://deb.debian.org/debian trixie/main i386 libcommons-compress-java all 1.25.0-1 [635 kB] -Get: 297 http://deb.debian.org/debian trixie/main i386 libcommons-io-java all 2.16.0-1 [484 kB] -Get: 298 http://deb.debian.org/debian trixie/main i386 libcommons-lang-java all 2.6-10 [273 kB] -Get: 299 http://deb.debian.org/debian trixie/main i386 liberror-prone-java all 2.18.0-1 [22.5 kB] -Get: 300 http://deb.debian.org/debian trixie/main i386 libjsr305-java all 0.1~+svn49-11 [26.9 kB] -Get: 301 http://deb.debian.org/debian trixie/main i386 libguava-java all 32.0.1-1 [2708 kB] -Get: 302 http://deb.debian.org/debian trixie/main i386 libcommons-codec-java all 1.16.0-1 [297 kB] -Get: 303 http://deb.debian.org/debian trixie/main i386 libhttpcore-java all 4.4.16-1 [636 kB] -Get: 304 http://deb.debian.org/debian trixie/main i386 libhttpclient-java all 4.5.14-1 [1247 kB] -Get: 305 http://deb.debian.org/debian trixie/main i386 libjarjar-java all 1.4+svn142-12 [205 kB] -Get: 306 http://deb.debian.org/debian trixie/main i386 libjcip-annotations-java all 20060626-6 [11.8 kB] -Get: 307 http://deb.debian.org/debian trixie/main i386 libjna-jni i386 5.14.0-1 [63.9 kB] -Get: 308 http://deb.debian.org/debian trixie/main i386 libjna-java all 5.14.0-1 [237 kB] -Get: 309 http://deb.debian.org/debian trixie/main i386 libjzlib-java all 1.1.3-3 [79.4 kB] -Get: 310 http://deb.debian.org/debian trixie/main i386 libjsch-java all 0.1.55-1 [298 kB] -Get: 311 http://deb.debian.org/debian trixie/main i386 libminlog-java all 1.3.0-1.1 [7928 B] -Get: 312 http://deb.debian.org/debian trixie/main i386 libobjenesis-java all 3.3-3 [41.3 kB] -Get: 313 http://deb.debian.org/debian trixie/main i386 libreflectasm-java all 1.11.9+dfsg-4 [25.0 kB] -Get: 314 http://deb.debian.org/debian trixie/main i386 libkryo-java all 2.20-7 [158 kB] -Get: 315 http://deb.debian.org/debian trixie/main i386 liblogback-java all 1:1.2.11-5 [701 kB] -Get: 316 http://deb.debian.org/debian trixie/main i386 libnative-platform-jni i386 0.14-6 [12.2 kB] -Get: 317 http://deb.debian.org/debian trixie/main i386 libnative-platform-java all 0.14-6 [69.8 kB] -Get: 318 http://deb.debian.org/debian trixie/main i386 libxml-commons-external-java all 1.4.01-6 [240 kB] -Get: 319 http://deb.debian.org/debian trixie/main i386 libxml-commons-resolver1.1-java all 1.2-11 [98.3 kB] -Get: 320 http://deb.debian.org/debian trixie/main i386 libxerces2-java all 2.12.2-1 [1440 kB] -Get: 321 http://deb.debian.org/debian trixie/main i386 libnekohtml-java all 1.9.22.noko2-0.1 [125 kB] -Get: 322 http://deb.debian.org/debian trixie/main i386 libxbean-reflect-java all 4.5-8 [133 kB] -Get: 323 http://deb.debian.org/debian trixie/main i386 libgradle-core-java all 4.4.1-20 [4293 kB] -Get: 324 http://deb.debian.org/debian trixie/main i386 libbcprov-java all 1.77-1 [5300 kB] -Get: 325 http://deb.debian.org/debian trixie/main i386 libbcpg-java all 1.77-1 [428 kB] -Get: 326 http://deb.debian.org/debian trixie/main i386 libbsh-java all 2.0b4-20 [291 kB] -Get: 327 http://deb.debian.org/debian trixie/main i386 libdd-plist-java all 1.20-1.1 [72.6 kB] -Get: 328 http://deb.debian.org/debian trixie/main i386 libjaxen-java all 1.1.6-4 [214 kB] -Get: 329 http://deb.debian.org/debian trixie/main i386 libdom4j-java all 2.1.4-1 [312 kB] -Get: 330 http://deb.debian.org/debian trixie/main i386 libbcel-java all 6.5.0-2 [634 kB] -Get: 331 http://deb.debian.org/debian trixie/main i386 libjformatstring-java all 0.10~20131207-2.1 [34.5 kB] -Get: 332 http://deb.debian.org/debian trixie/main i386 libfindbugs-java all 3.1.0~preview2-3 [3502 kB] -Get: 333 http://deb.debian.org/debian trixie/main i386 libgoogle-gson-java all 2.10.1-1 [262 kB] -Get: 334 http://deb.debian.org/debian trixie/main i386 libaopalliance-java all 20070526-7 [8572 B] -Get: 335 http://deb.debian.org/debian trixie/main i386 libguice-java all 4.2.3-2 [1435 kB] -Get: 336 http://deb.debian.org/debian trixie/main i386 libjatl-java all 0.2.3-1.1 [29.0 kB] -Get: 337 http://deb.debian.org/debian trixie/main i386 libjcifs-java all 1.3.19-2 [394 kB] -Get: 338 http://deb.debian.org/debian trixie/main i386 libeclipse-jdt-annotation-java all 2.2.700+eclipse4.26-2 [25.3 kB] -Get: 339 http://deb.debian.org/debian trixie/main i386 libjavaewah-java all 1.2.3-1 [159 kB] -Get: 340 http://deb.debian.org/debian trixie/main i386 libel-api-java all 3.0.0-3 [64.9 kB] -Get: 341 http://deb.debian.org/debian trixie/main i386 libwebsocket-api-java all 1.1-2 [40.1 kB] -Get: 342 http://deb.debian.org/debian trixie/main i386 libjetty9-java all 9.4.54-1 [2980 kB] -Get: 343 http://deb.debian.org/debian trixie/main i386 libjgit-java all 4.11.9-2 [2534 kB] -Get: 344 http://deb.debian.org/debian trixie/main i386 libjs-jquery all 3.6.1+dfsg+~3.5.14-1 [326 kB] -Get: 345 http://deb.debian.org/debian trixie/main i386 libcommons-lang3-java all 3.14.0-1 [621 kB] -Get: 346 http://deb.debian.org/debian trixie/main i386 libplexus-utils2-java all 3.4.2-1 [258 kB] -Get: 347 http://deb.debian.org/debian trixie/main i386 libwagon-provider-api-java all 3.5.3-1 [48.2 kB] -Get: 348 http://deb.debian.org/debian trixie/main i386 libmaven-resolver-java all 1.6.3-1 [548 kB] -Get: 349 http://deb.debian.org/debian trixie/main i386 libgeronimo-annotation-1.3-spec-java all 1.3-1 [11.1 kB] -Get: 350 http://deb.debian.org/debian trixie/main i386 libmaven-parent-java all 35-1 [6140 B] -Get: 351 http://deb.debian.org/debian trixie/main i386 libmaven-shared-utils-java all 3.3.4-1 [138 kB] -Get: 352 http://deb.debian.org/debian trixie/main i386 libplexus-cipher-java all 2.0-1 [14.9 kB] -Get: 353 http://deb.debian.org/debian trixie/main i386 libplexus-classworlds-java all 2.7.0-1 [50.6 kB] -Get: 354 http://deb.debian.org/debian trixie/main i386 libplexus-component-annotations-java all 2.1.1-1 [7660 B] -Get: 355 http://deb.debian.org/debian trixie/main i386 libplexus-interpolation-java all 1.26-1 [76.8 kB] -Get: 356 http://deb.debian.org/debian trixie/main i386 libplexus-sec-dispatcher-java all 2.0-3 [28.3 kB] -Get: 357 http://deb.debian.org/debian trixie/main i386 libgeronimo-interceptor-3.0-spec-java all 1.0.1-4 [8484 B] -Get: 358 http://deb.debian.org/debian trixie/main i386 libcdi-api-java all 1.2-3 [54.3 kB] -Get: 359 http://deb.debian.org/debian trixie/main i386 libsisu-inject-java all 0.3.4-2 [347 kB] -Get: 360 http://deb.debian.org/debian trixie/main i386 libsisu-plexus-java all 0.3.4-3 [181 kB] -Get: 361 http://deb.debian.org/debian trixie/main i386 libmaven3-core-java all 3.8.7-2 [1573 kB] -Get: 362 http://deb.debian.org/debian trixie/main i386 libplexus-container-default-java all 2.1.1-1 [193 kB] -Get: 363 http://deb.debian.org/debian trixie/main i386 libpolyglot-maven-java all 0.8~tobrien+git20120905-10 [74.9 kB] -Get: 364 http://deb.debian.org/debian trixie/main i386 librhino-java all 1.7.14-2.1 [1357 kB] -Get: 365 http://deb.debian.org/debian trixie/main i386 libsimple-http-java all 4.1.21-1.1 [211 kB] -Get: 366 http://deb.debian.org/debian trixie/main i386 libwagon-file-java all 3.5.3-1 [8388 B] -Get: 367 http://deb.debian.org/debian trixie/main i386 libjsoup-java all 1.15.3-1 [431 kB] -Get: 368 http://deb.debian.org/debian trixie/main i386 libwagon-http-java all 3.5.3-1 [49.5 kB] -Get: 369 http://deb.debian.org/debian trixie/main i386 libjcommander-java all 1.71-4 [73.0 kB] -Get: 370 http://deb.debian.org/debian trixie/main i386 testng all 6.9.12-4 [795 kB] -Get: 371 http://deb.debian.org/debian trixie/main i386 libgradle-plugins-java all 4.4.1-20 [5206 kB] -Get: 372 http://deb.debian.org/debian trixie/main i386 gradle all 4.4.1-20 [398 kB] -Get: 373 http://deb.debian.org/debian trixie/main i386 maven-repo-helper all 1.11 [142 kB] -Get: 374 http://deb.debian.org/debian trixie/main i386 gradle-debian-helper all 2.4 [24.5 kB] -Get: 375 http://deb.debian.org/debian trixie/main i386 jarwrapper all 0.79 [10.1 kB] -Get: 376 http://deb.debian.org/debian trixie/main i386 javahelper all 0.79 [84.6 kB] -Get: 377 http://deb.debian.org/debian trixie/main i386 libbyte-buddy-java all 1.14.13-1 [4709 kB] -Get: 378 http://deb.debian.org/debian trixie/main i386 libcommons-math3-java all 3.6.1-3 [2018 kB] -Get: 379 http://deb.debian.org/debian trixie/main i386 libjackson2-annotations-java all 2.14.0-1 [68.8 kB] -Get: 380 http://deb.debian.org/debian trixie/main i386 libjackson2-core-java all 2.14.1-1 [447 kB] -Get: 381 http://deb.debian.org/debian trixie/main i386 libjackson2-databind-java all 2.14.0-1 [1584 kB] -Get: 382 http://deb.debian.org/debian trixie/main i386 liblz4-jni i386 1.8.0-4 [10.4 kB] -Get: 383 http://deb.debian.org/debian trixie/main i386 liblz4-java all 1.8.0-4 [116 kB] -Get: 384 http://deb.debian.org/debian trixie/main i386 libmockito-java all 2.23.0-2 [479 kB] -Get: 385 http://deb.debian.org/debian trixie/main i386 libredberry-pipe-java all 1.0.0~alpha0-3 [62.7 kB] -Get: 386 http://deb.debian.org/debian trixie/main i386 libtrove3-java all 3.0.3-5 [2146 kB] -Fetched 341 MB in 4s (83.6 MB/s) +Get: 150 http://deb.debian.org/debian trixie/main i386 libcups2t64 i386 2.4.7-1.2+b1 [264 kB] +Get: 151 http://deb.debian.org/debian trixie/main i386 libepoxy0 i386 1.5.10-1+b2 [196 kB] +Get: 152 http://deb.debian.org/debian trixie/main i386 libfribidi0 i386 1.0.13-3+b1 [71.8 kB] +Get: 153 http://deb.debian.org/debian trixie/main i386 libgraphite2-3 i386 1.3.14-2 [77.7 kB] +Get: 154 http://deb.debian.org/debian trixie/main i386 libharfbuzz0b i386 8.3.0-2+b1 [2234 kB] +Get: 155 http://deb.debian.org/debian trixie/main i386 fontconfig i386 2.15.0-1.1 [462 kB] +Get: 156 http://deb.debian.org/debian trixie/main i386 libthai-data all 0.1.29-2 [168 kB] +Get: 157 http://deb.debian.org/debian trixie/main i386 libdatrie1 i386 0.2.13-3 [39.5 kB] +Get: 158 http://deb.debian.org/debian trixie/main i386 libthai0 i386 0.1.29-2 [50.1 kB] +Get: 159 http://deb.debian.org/debian trixie/main i386 libpango-1.0-0 i386 1.52.1+ds-1 [224 kB] +Get: 160 http://deb.debian.org/debian trixie/main i386 libpangoft2-1.0-0 i386 1.52.1+ds-1 [51.1 kB] +Get: 161 http://deb.debian.org/debian trixie/main i386 libpangocairo-1.0-0 i386 1.52.1+ds-1 [36.0 kB] +Get: 162 http://deb.debian.org/debian trixie/main i386 libwayland-client0 i386 1.22.0-2.1+b1 [26.4 kB] +Get: 163 http://deb.debian.org/debian trixie/main i386 libwayland-cursor0 i386 1.22.0-2.1+b1 [12.0 kB] +Get: 164 http://deb.debian.org/debian trixie/main i386 libwayland-egl1 i386 1.22.0-2.1+b1 [5712 B] +Get: 165 http://deb.debian.org/debian trixie/main i386 libxcomposite1 i386 1:0.4.5-1+b1 [15.2 kB] +Get: 166 http://deb.debian.org/debian trixie/main i386 libxfixes3 i386 1:6.0.0-2+b1 [20.7 kB] +Get: 167 http://deb.debian.org/debian trixie/main i386 libxcursor1 i386 1:1.2.1-1+b1 [37.6 kB] +Get: 168 http://deb.debian.org/debian trixie/main i386 libxdamage1 i386 1:1.1.6-1+b1 [15.6 kB] +Get: 169 http://deb.debian.org/debian trixie/main i386 libxinerama1 i386 2:1.1.4-3+b1 [16.3 kB] +Get: 170 http://deb.debian.org/debian trixie/main i386 xkb-data all 2.41-2 [795 kB] +Get: 171 http://deb.debian.org/debian trixie/main i386 libxkbcommon0 i386 1.6.0-1+b1 [115 kB] +Get: 172 http://deb.debian.org/debian trixie/main i386 libxrandr2 i386 2:1.5.4-1 [37.7 kB] +Get: 173 http://deb.debian.org/debian trixie/main i386 libgtk-3-common all 3.24.41-4 [4635 kB] +Get: 174 http://deb.debian.org/debian trixie/main i386 libgtk-3-0t64 i386 3.24.41-4 [2897 kB] +Get: 175 http://deb.debian.org/debian trixie/main i386 libglvnd0 i386 1.7.0-1+b1 [44.4 kB] +Get: 176 http://deb.debian.org/debian trixie/main i386 libdrm-common all 2.4.120-2 [7688 B] +Get: 177 http://deb.debian.org/debian trixie/main i386 libdrm2 i386 2.4.120-2 [41.4 kB] +Get: 178 http://deb.debian.org/debian trixie/main i386 libglapi-mesa i386 23.3.5-1 [35.4 kB] +Get: 179 http://deb.debian.org/debian trixie/main i386 libx11-xcb1 i386 2:1.8.7-1+b1 [232 kB] +Get: 180 http://deb.debian.org/debian trixie/main i386 libxcb-dri2-0 i386 1.15-1 [107 kB] +Get: 181 http://deb.debian.org/debian trixie/main i386 libxcb-dri3-0 i386 1.15-1 [107 kB] +Get: 182 http://deb.debian.org/debian trixie/main i386 libxcb-glx0 i386 1.15-1 [124 kB] +Get: 183 http://deb.debian.org/debian trixie/main i386 libxcb-present0 i386 1.15-1 [106 kB] +Get: 184 http://deb.debian.org/debian trixie/main i386 libxcb-randr0 i386 1.15-1 [118 kB] +Get: 185 http://deb.debian.org/debian trixie/main i386 libxcb-sync1 i386 1.15-1 [109 kB] +Get: 186 http://deb.debian.org/debian trixie/main i386 libxcb-xfixes0 i386 1.15-1 [110 kB] +Get: 187 http://deb.debian.org/debian trixie/main i386 libxshmfence1 i386 1.3-1+b1 [9028 B] +Get: 188 http://deb.debian.org/debian trixie/main i386 libxxf86vm1 i386 1:1.1.4-1+b2 [21.7 kB] +Get: 189 http://deb.debian.org/debian trixie/main i386 libvulkan1 i386 1.3.280.0-1 [132 kB] +Get: 190 http://deb.debian.org/debian trixie/main i386 libdrm-amdgpu1 i386 2.4.120-2 [24.4 kB] +Get: 191 http://deb.debian.org/debian trixie/main i386 libpciaccess0 i386 0.17-3+b1 [53.8 kB] +Get: 192 http://deb.debian.org/debian trixie/main i386 libdrm-intel1 i386 2.4.120-2 [66.5 kB] +Get: 193 http://deb.debian.org/debian trixie/main i386 libdrm-nouveau2 i386 2.4.120-2 [20.8 kB] +Get: 194 http://deb.debian.org/debian trixie/main i386 libdrm-radeon1 i386 2.4.120-2 [23.0 kB] +Get: 195 http://deb.debian.org/debian trixie/main i386 libedit2 i386 3.1-20230828-1+b1 [97.8 kB] +Get: 196 http://deb.debian.org/debian trixie/main i386 libz3-4 i386 4.8.12-3.1+b2 [7989 kB] +Get: 197 http://deb.debian.org/debian trixie/main i386 libllvm17t64 i386 1:17.0.6-11 [27.7 MB] +Get: 198 http://deb.debian.org/debian trixie/main i386 libsensors-config all 1:3.6.0-9 [14.6 kB] +Get: 199 http://deb.debian.org/debian trixie/main i386 libsensors5 i386 1:3.6.0-9 [35.4 kB] +Get: 200 http://deb.debian.org/debian trixie/main i386 libgl1-mesa-dri i386 23.3.5-1 [8327 kB] +Get: 201 http://deb.debian.org/debian trixie/main i386 libglx-mesa0 i386 23.3.5-1 [157 kB] +Get: 202 http://deb.debian.org/debian trixie/main i386 libglx0 i386 1.7.0-1+b1 [38.0 kB] +Get: 203 http://deb.debian.org/debian trixie/main i386 libgl1 i386 1.7.0-1+b1 [82.7 kB] +Get: 204 http://deb.debian.org/debian trixie/main i386 libasound2-data all 1.2.11-1 [20.9 kB] +Get: 205 http://deb.debian.org/debian trixie/main i386 libasound2t64 i386 1.2.11-1+b1 [395 kB] +Get: 206 http://deb.debian.org/debian trixie/main i386 libgif7 i386 5.2.2-1 [45.3 kB] +Get: 207 http://deb.debian.org/debian trixie/main i386 libxtst6 i386 2:1.2.3-1.1+b1 [26.5 kB] +Get: 208 http://deb.debian.org/debian trixie/main i386 openjdk-17-jre i386 17.0.11+9-1 [184 kB] +Get: 209 http://deb.debian.org/debian trixie/main i386 default-jre i386 2:1.17-75 [1056 B] +Get: 210 http://deb.debian.org/debian trixie/main i386 openjdk-17-jdk-headless i386 17.0.11+9-1 [74.0 MB] +Get: 211 http://deb.debian.org/debian trixie/main i386 default-jdk-headless i386 2:1.17-75 [1108 B] +Get: 212 http://deb.debian.org/debian trixie/main i386 openjdk-17-jdk i386 17.0.11+9-1 [10.4 kB] +Get: 213 http://deb.debian.org/debian trixie/main i386 default-jdk i386 2:1.17-75 [1068 B] +Get: 214 http://deb.debian.org/debian trixie/main i386 libassuan0 i386 2.5.6-1+b1 [52.2 kB] +Get: 215 http://deb.debian.org/debian trixie/main i386 gpgconf i386 2.2.40-1.1+b1 [572 kB] +Get: 216 http://deb.debian.org/debian trixie/main i386 libksba8 i386 1.6.6-1 [138 kB] +Get: 217 http://deb.debian.org/debian trixie/main i386 libsasl2-modules-db i386 2.1.28+dfsg1-4+b1 [20.7 kB] +Get: 218 http://deb.debian.org/debian trixie/main i386 libsasl2-2 i386 2.1.28+dfsg1-4+b1 [60.7 kB] +Get: 219 http://deb.debian.org/debian trixie/main i386 libldap-2.5-0 i386 2.5.13+dfsg-5+b3 [196 kB] +Get: 220 http://deb.debian.org/debian trixie/main i386 libnpth0t64 i386 1.6-3.1 [18.0 kB] +Get: 221 http://deb.debian.org/debian trixie/main i386 dirmngr i386 2.2.40-1.1+b1 [820 kB] +Get: 222 http://deb.debian.org/debian trixie/main i386 gnupg-l10n all 2.2.40-1.1 [1093 kB] +Get: 223 http://deb.debian.org/debian trixie/main i386 gnupg-utils i386 2.2.40-1.1+b1 [973 kB] +Get: 224 http://deb.debian.org/debian trixie/main i386 gpg i386 2.2.40-1.1+b1 [991 kB] +Get: 225 http://deb.debian.org/debian trixie/main i386 pinentry-curses i386 1.2.1-3 [79.4 kB] +Get: 226 http://deb.debian.org/debian trixie/main i386 gpg-agent i386 2.2.40-1.1+b1 [716 kB] +Get: 227 http://deb.debian.org/debian trixie/main i386 gpg-wks-client i386 2.2.40-1.1+b1 [551 kB] +Get: 228 http://deb.debian.org/debian trixie/main i386 gpg-wks-server i386 2.2.40-1.1+b1 [541 kB] +Get: 229 http://deb.debian.org/debian trixie/main i386 gpgsm i386 2.2.40-1.1+b1 [691 kB] +Get: 230 http://deb.debian.org/debian trixie/main i386 gnupg all 2.2.40-1.1 [846 kB] +Get: 231 http://deb.debian.org/debian trixie/main i386 libfile-dirlist-perl all 0.05-3 [7600 B] +Get: 232 http://deb.debian.org/debian trixie/main i386 libfile-which-perl all 1.27-2 [15.1 kB] +Get: 233 http://deb.debian.org/debian trixie/main i386 libfile-homedir-perl all 1.006-2 [42.4 kB] +Get: 234 http://deb.debian.org/debian trixie/main i386 libfile-touch-perl all 0.12-2 [8816 B] +Get: 235 http://deb.debian.org/debian trixie/main i386 libio-pty-perl i386 1:1.20-1 [35.7 kB] +Get: 236 http://deb.debian.org/debian trixie/main i386 libipc-run-perl all 20231003.0-2 [101 kB] +Get: 237 http://deb.debian.org/debian trixie/main i386 libclass-method-modifiers-perl all 2.15-1 [18.0 kB] +Get: 238 http://deb.debian.org/debian trixie/main i386 libclass-xsaccessor-perl i386 1.19-4+b2 [37.7 kB] +Get: 239 http://deb.debian.org/debian trixie/main i386 libb-hooks-op-check-perl i386 0.22-2+b2 [10.7 kB] +Get: 240 http://deb.debian.org/debian trixie/main i386 libdynaloader-functions-perl all 0.003-3 [12.7 kB] +Get: 241 http://deb.debian.org/debian trixie/main i386 libdevel-callchecker-perl i386 0.008-2+b1 [15.1 kB] +Get: 242 http://deb.debian.org/debian trixie/main i386 libparams-classify-perl i386 0.015-2+b2 [23.1 kB] +Get: 243 http://deb.debian.org/debian trixie/main i386 libmodule-runtime-perl all 0.016-2 [19.6 kB] +Get: 244 http://deb.debian.org/debian trixie/main i386 libimport-into-perl all 1.002005-2 [11.3 kB] +Get: 245 http://deb.debian.org/debian trixie/main i386 librole-tiny-perl all 2.002004-1 [21.4 kB] +Get: 246 http://deb.debian.org/debian trixie/main i386 libsub-quote-perl all 2.006008-1 [21.8 kB] +Get: 247 http://deb.debian.org/debian trixie/main i386 libmoo-perl all 2.005005-1 [58.0 kB] +Get: 248 http://deb.debian.org/debian trixie/main i386 libencode-locale-perl all 1.05-3 [12.9 kB] +Get: 249 http://deb.debian.org/debian trixie/main i386 libtimedate-perl all 2.3300-2 [39.3 kB] +Get: 250 http://deb.debian.org/debian trixie/main i386 libhttp-date-perl all 6.06-1 [10.7 kB] +Get: 251 http://deb.debian.org/debian trixie/main i386 libfile-listing-perl all 6.16-1 [12.4 kB] +Get: 252 http://deb.debian.org/debian trixie/main i386 libhtml-tagset-perl all 3.24-1 [14.7 kB] +Get: 253 http://deb.debian.org/debian trixie/main i386 liburi-perl all 5.28-1 [98.6 kB] +Get: 254 http://deb.debian.org/debian trixie/main i386 libhtml-parser-perl i386 3.81-1+b1 [100 kB] +Get: 255 http://deb.debian.org/debian trixie/main i386 libhtml-tree-perl all 5.07-3 [211 kB] +Get: 256 http://deb.debian.org/debian trixie/main i386 libclone-perl i386 0.46-1+b1 [13.9 kB] +Get: 257 http://deb.debian.org/debian trixie/main i386 libio-html-perl all 1.004-3 [16.2 kB] +Get: 258 http://deb.debian.org/debian trixie/main i386 liblwp-mediatypes-perl all 6.04-2 [20.2 kB] +Get: 259 http://deb.debian.org/debian trixie/main i386 libhttp-message-perl all 6.45-1 [82.0 kB] +Get: 260 http://deb.debian.org/debian trixie/main i386 libhttp-cookies-perl all 6.11-1 [19.1 kB] +Get: 261 http://deb.debian.org/debian trixie/main i386 libhttp-negotiate-perl all 6.01-2 [13.1 kB] +Get: 262 http://deb.debian.org/debian trixie/main i386 perl-openssl-defaults i386 7+b2 [6720 B] +Get: 263 http://deb.debian.org/debian trixie/main i386 libnet-ssleay-perl i386 1.94-1 [339 kB] +Get: 264 http://deb.debian.org/debian trixie/main i386 libio-socket-ssl-perl all 2.085-1 [218 kB] +Get: 265 http://deb.debian.org/debian trixie/main i386 libnet-http-perl all 6.23-1 [23.9 kB] +Get: 266 http://deb.debian.org/debian trixie/main i386 liblwp-protocol-https-perl all 6.14-1 [10.8 kB] +Get: 267 http://deb.debian.org/debian trixie/main i386 libtry-tiny-perl all 0.31-2 [22.6 kB] +Get: 268 http://deb.debian.org/debian trixie/main i386 libwww-robotrules-perl all 6.02-1 [12.9 kB] +Get: 269 http://deb.debian.org/debian trixie/main i386 libwww-perl all 6.77-1 [183 kB] +Get: 270 http://deb.debian.org/debian trixie/main i386 patchutils i386 0.4.2-1 [79.6 kB] +Get: 271 http://deb.debian.org/debian trixie/main i386 wdiff i386 1.2.2-6 [120 kB] +Get: 272 http://deb.debian.org/debian trixie/main i386 devscripts all 2.23.7 [1068 kB] +Get: 273 http://deb.debian.org/debian trixie/main i386 fastjar i386 2:0.98-7 [47.3 kB] +Get: 274 http://deb.debian.org/debian trixie/main i386 ivy all 2.5.2-1 [1295 kB] +Get: 275 http://deb.debian.org/debian trixie/main i386 libasm-java all 9.7-1 [394 kB] +Get: 276 http://deb.debian.org/debian trixie/main i386 libbsf-java all 1:2.4.0-8 [76.3 kB] +Get: 277 http://deb.debian.org/debian trixie/main i386 libcommons-cli-java all 1.6.0-1 [60.4 kB] +Get: 278 http://deb.debian.org/debian trixie/main i386 libapache-pom-java all 29-2 [5276 B] +Get: 279 http://deb.debian.org/debian trixie/main i386 libcommons-parent-java all 56-1 [10.8 kB] +Get: 280 http://deb.debian.org/debian trixie/main i386 libcommons-logging-java all 1.3.0-1 [68.6 kB] +Get: 281 http://deb.debian.org/debian trixie/main i386 libjansi-java all 2.4.1-2 [100 kB] +Get: 282 http://deb.debian.org/debian trixie/main i386 libjsp-api-java all 2.3.4-3 [53.7 kB] +Get: 283 http://deb.debian.org/debian trixie/main i386 libqdox-java all 1.12.1-3 [172 kB] +Get: 284 http://deb.debian.org/debian trixie/main i386 libservlet-api-java all 4.0.1-2 [81.0 kB] +Get: 285 http://deb.debian.org/debian trixie/main i386 libxpp3-java all 1.1.4c-3 [292 kB] +Get: 286 http://deb.debian.org/debian trixie/main i386 libxstream-java all 1.4.20-1 [565 kB] +Get: 287 http://deb.debian.org/debian trixie/main i386 groovy all 2.4.21-10 [12.8 MB] +Get: 288 http://deb.debian.org/debian trixie/main i386 libatinject-jsr330-api-java all 1.0+ds1-5 [5312 B] +Get: 289 http://deb.debian.org/debian trixie/main i386 libcommons-collections3-java all 3.2.2-3 [530 kB] +Get: 290 http://deb.debian.org/debian trixie/main i386 libcommons-compress-java all 1.25.0-1 [635 kB] +Get: 291 http://deb.debian.org/debian trixie/main i386 libcommons-io-java all 2.16.0-1 [484 kB] +Get: 292 http://deb.debian.org/debian trixie/main i386 libcommons-lang-java all 2.6-10 [273 kB] +Get: 293 http://deb.debian.org/debian trixie/main i386 liberror-prone-java all 2.18.0-1 [22.5 kB] +Get: 294 http://deb.debian.org/debian trixie/main i386 libjsr305-java all 0.1~+svn49-11 [26.9 kB] +Get: 295 http://deb.debian.org/debian trixie/main i386 libguava-java all 32.0.1-1 [2708 kB] +Get: 296 http://deb.debian.org/debian trixie/main i386 libcommons-codec-java all 1.16.0-1 [297 kB] +Get: 297 http://deb.debian.org/debian trixie/main i386 libhttpcore-java all 4.4.16-1 [636 kB] +Get: 298 http://deb.debian.org/debian trixie/main i386 libhttpclient-java all 4.5.14-1 [1247 kB] +Get: 299 http://deb.debian.org/debian trixie/main i386 libjarjar-java all 1.4+svn142-12 [205 kB] +Get: 300 http://deb.debian.org/debian trixie/main i386 libjcip-annotations-java all 20060626-6 [11.8 kB] +Get: 301 http://deb.debian.org/debian trixie/main i386 libjna-jni i386 5.14.0-1 [63.9 kB] +Get: 302 http://deb.debian.org/debian trixie/main i386 libjna-java all 5.14.0-1 [237 kB] +Get: 303 http://deb.debian.org/debian trixie/main i386 libjzlib-java all 1.1.3-3 [79.4 kB] +Get: 304 http://deb.debian.org/debian trixie/main i386 libjsch-java all 0.1.55-1 [298 kB] +Get: 305 http://deb.debian.org/debian trixie/main i386 libminlog-java all 1.3.0-1.1 [7928 B] +Get: 306 http://deb.debian.org/debian trixie/main i386 libobjenesis-java all 3.3-3 [41.3 kB] +Get: 307 http://deb.debian.org/debian trixie/main i386 libreflectasm-java all 1.11.9+dfsg-4 [25.0 kB] +Get: 308 http://deb.debian.org/debian trixie/main i386 libkryo-java all 2.20-7 [158 kB] +Get: 309 http://deb.debian.org/debian trixie/main i386 liblogback-java all 1:1.2.11-5 [701 kB] +Get: 310 http://deb.debian.org/debian trixie/main i386 libnative-platform-jni i386 0.14-6 [12.2 kB] +Get: 311 http://deb.debian.org/debian trixie/main i386 libnative-platform-java all 0.14-6 [69.8 kB] +Get: 312 http://deb.debian.org/debian trixie/main i386 libxml-commons-external-java all 1.4.01-6 [240 kB] +Get: 313 http://deb.debian.org/debian trixie/main i386 libxml-commons-resolver1.1-java all 1.2-11 [98.3 kB] +Get: 314 http://deb.debian.org/debian trixie/main i386 libxerces2-java all 2.12.2-1 [1440 kB] +Get: 315 http://deb.debian.org/debian trixie/main i386 libnekohtml-java all 1.9.22.noko2-0.1 [125 kB] +Get: 316 http://deb.debian.org/debian trixie/main i386 libxbean-reflect-java all 4.5-8 [133 kB] +Get: 317 http://deb.debian.org/debian trixie/main i386 libgradle-core-java all 4.4.1-20 [4293 kB] +Get: 318 http://deb.debian.org/debian trixie/main i386 libbcprov-java all 1.77-1 [5300 kB] +Get: 319 http://deb.debian.org/debian trixie/main i386 libbcpg-java all 1.77-1 [428 kB] +Get: 320 http://deb.debian.org/debian trixie/main i386 libbsh-java all 2.0b4-20 [291 kB] +Get: 321 http://deb.debian.org/debian trixie/main i386 libdd-plist-java all 1.20-1.1 [72.6 kB] +Get: 322 http://deb.debian.org/debian trixie/main i386 libjaxen-java all 1.1.6-4 [214 kB] +Get: 323 http://deb.debian.org/debian trixie/main i386 libdom4j-java all 2.1.4-1 [312 kB] +Get: 324 http://deb.debian.org/debian trixie/main i386 libbcel-java all 6.5.0-2 [634 kB] +Get: 325 http://deb.debian.org/debian trixie/main i386 libjformatstring-java all 0.10~20131207-2.1 [34.5 kB] +Get: 326 http://deb.debian.org/debian trixie/main i386 libfindbugs-java all 3.1.0~preview2-3 [3502 kB] +Get: 327 http://deb.debian.org/debian trixie/main i386 libgoogle-gson-java all 2.10.1-1 [262 kB] +Get: 328 http://deb.debian.org/debian trixie/main i386 libaopalliance-java all 20070526-7 [8572 B] +Get: 329 http://deb.debian.org/debian trixie/main i386 libguice-java all 4.2.3-2 [1435 kB] +Get: 330 http://deb.debian.org/debian trixie/main i386 libjatl-java all 0.2.3-1.1 [29.0 kB] +Get: 331 http://deb.debian.org/debian trixie/main i386 libjcifs-java all 1.3.19-2 [394 kB] +Get: 332 http://deb.debian.org/debian trixie/main i386 libeclipse-jdt-annotation-java all 2.2.700+eclipse4.26-2 [25.3 kB] +Get: 333 http://deb.debian.org/debian trixie/main i386 libjavaewah-java all 1.2.3-1 [159 kB] +Get: 334 http://deb.debian.org/debian trixie/main i386 libel-api-java all 3.0.0-3 [64.9 kB] +Get: 335 http://deb.debian.org/debian trixie/main i386 libwebsocket-api-java all 1.1-2 [40.1 kB] +Get: 336 http://deb.debian.org/debian trixie/main i386 libjetty9-java all 9.4.54-1 [2980 kB] +Get: 337 http://deb.debian.org/debian trixie/main i386 libjgit-java all 4.11.9-2 [2534 kB] +Get: 338 http://deb.debian.org/debian trixie/main i386 libjs-jquery all 3.6.1+dfsg+~3.5.14-1 [326 kB] +Get: 339 http://deb.debian.org/debian trixie/main i386 libcommons-lang3-java all 3.14.0-1 [621 kB] +Get: 340 http://deb.debian.org/debian trixie/main i386 libplexus-utils2-java all 3.4.2-1 [258 kB] +Get: 341 http://deb.debian.org/debian trixie/main i386 libwagon-provider-api-java all 3.5.3-1 [48.2 kB] +Get: 342 http://deb.debian.org/debian trixie/main i386 libmaven-resolver-java all 1.6.3-1 [548 kB] +Get: 343 http://deb.debian.org/debian trixie/main i386 libgeronimo-annotation-1.3-spec-java all 1.3-1 [11.1 kB] +Get: 344 http://deb.debian.org/debian trixie/main i386 libmaven-parent-java all 35-1 [6140 B] +Get: 345 http://deb.debian.org/debian trixie/main i386 libmaven-shared-utils-java all 3.3.4-1 [138 kB] +Get: 346 http://deb.debian.org/debian trixie/main i386 libplexus-cipher-java all 2.0-1 [14.9 kB] +Get: 347 http://deb.debian.org/debian trixie/main i386 libplexus-classworlds-java all 2.7.0-1 [50.6 kB] +Get: 348 http://deb.debian.org/debian trixie/main i386 libplexus-component-annotations-java all 2.1.1-1 [7660 B] +Get: 349 http://deb.debian.org/debian trixie/main i386 libplexus-interpolation-java all 1.26-1 [76.8 kB] +Get: 350 http://deb.debian.org/debian trixie/main i386 libplexus-sec-dispatcher-java all 2.0-3 [28.3 kB] +Get: 351 http://deb.debian.org/debian trixie/main i386 libgeronimo-interceptor-3.0-spec-java all 1.0.1-4 [8484 B] +Get: 352 http://deb.debian.org/debian trixie/main i386 libcdi-api-java all 1.2-3 [54.3 kB] +Get: 353 http://deb.debian.org/debian trixie/main i386 libsisu-inject-java all 0.3.4-2 [347 kB] +Get: 354 http://deb.debian.org/debian trixie/main i386 libsisu-plexus-java all 0.3.4-3 [181 kB] +Get: 355 http://deb.debian.org/debian trixie/main i386 libmaven3-core-java all 3.8.7-2 [1573 kB] +Get: 356 http://deb.debian.org/debian trixie/main i386 libplexus-container-default-java all 2.1.1-1 [193 kB] +Get: 357 http://deb.debian.org/debian trixie/main i386 libpolyglot-maven-java all 0.8~tobrien+git20120905-10 [74.9 kB] +Get: 358 http://deb.debian.org/debian trixie/main i386 librhino-java all 1.7.14-2.1 [1357 kB] +Get: 359 http://deb.debian.org/debian trixie/main i386 libsimple-http-java all 4.1.21-1.1 [211 kB] +Get: 360 http://deb.debian.org/debian trixie/main i386 libwagon-file-java all 3.5.3-1 [8388 B] +Get: 361 http://deb.debian.org/debian trixie/main i386 libjsoup-java all 1.15.3-1 [431 kB] +Get: 362 http://deb.debian.org/debian trixie/main i386 libwagon-http-java all 3.5.3-1 [49.5 kB] +Get: 363 http://deb.debian.org/debian trixie/main i386 libjcommander-java all 1.71-4 [73.0 kB] +Get: 364 http://deb.debian.org/debian trixie/main i386 testng all 6.9.12-4 [795 kB] +Get: 365 http://deb.debian.org/debian trixie/main i386 libgradle-plugins-java all 4.4.1-20 [5206 kB] +Get: 366 http://deb.debian.org/debian trixie/main i386 gradle all 4.4.1-20 [398 kB] +Get: 367 http://deb.debian.org/debian trixie/main i386 maven-repo-helper all 1.11 [142 kB] +Get: 368 http://deb.debian.org/debian trixie/main i386 gradle-debian-helper all 2.4 [24.5 kB] +Get: 369 http://deb.debian.org/debian trixie/main i386 jarwrapper all 0.79 [10.1 kB] +Get: 370 http://deb.debian.org/debian trixie/main i386 javahelper all 0.79 [84.6 kB] +Get: 371 http://deb.debian.org/debian trixie/main i386 libbyte-buddy-java all 1.14.13-1 [4709 kB] +Get: 372 http://deb.debian.org/debian trixie/main i386 libcommons-math3-java all 3.6.1-3 [2018 kB] +Get: 373 http://deb.debian.org/debian trixie/main i386 libjackson2-annotations-java all 2.14.0-1 [68.8 kB] +Get: 374 http://deb.debian.org/debian trixie/main i386 libjackson2-core-java all 2.14.1-1 [447 kB] +Get: 375 http://deb.debian.org/debian trixie/main i386 libjackson2-databind-java all 2.14.0-1 [1584 kB] +Get: 376 http://deb.debian.org/debian trixie/main i386 liblz4-jni i386 1.8.0-4 [10.4 kB] +Get: 377 http://deb.debian.org/debian trixie/main i386 liblz4-java all 1.8.0-4 [116 kB] +Get: 378 http://deb.debian.org/debian trixie/main i386 libmockito-java all 2.23.0-2 [479 kB] +Get: 379 http://deb.debian.org/debian trixie/main i386 libredberry-pipe-java all 1.0.0~alpha0-3 [62.7 kB] +Get: 380 http://deb.debian.org/debian trixie/main i386 libtrove3-java all 3.0.3-5 [2146 kB] +Fetched 341 MB in 7s (49.3 MB/s) debconf: delaying package configuration, since apt-utils is not installed dpkg: libdb5.3:i386: dependency problems, but removing anyway as you requested: libperl5.38:i386 depends on libdb5.3. libpam-modules:i386 depends on libdb5.3. -(Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19709 files and directories currently installed.) +(Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19885 files and directories currently installed.) Removing libdb5.3:i386 (5.3.28+dfsg2-4+b1) ... Selecting previously unselected package libdb5.3t64:i386. -(Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19702 files and directories currently installed.) +(Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19878 files and directories currently installed.) Preparing to unpack .../libdb5.3t64_5.3.28+dfsg2-7_i386.deb ... Unpacking libdb5.3t64:i386 (5.3.28+dfsg2-7) ... Setting up libdb5.3t64:i386 (5.3.28+dfsg2-7) ... dpkg: libssl3:i386: dependency problems, but removing anyway as you requested: + libkrb5-3:i386 depends on libssl3 (>= 3.0.0). coreutils depends on libssl3 (>= 3.0.0). -(Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19708 files and directories currently installed.) +(Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19884 files and directories currently installed.) Removing libssl3:i386 (3.1.5-1) ... Selecting previously unselected package libssl3t64:i386. -(Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19695 files and directories currently installed.) +(Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19871 files and directories currently installed.) Preparing to unpack .../libssl3t64_3.2.1-3_i386.deb ... Unpacking libssl3t64:i386 (3.2.1-3) ... Setting up libssl3t64:i386 (3.2.1-3) ... Selecting previously unselected package libapparmor1:i386. -(Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19710 files and directories currently installed.) +(Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19886 files and directories currently installed.) Preparing to unpack .../00-libapparmor1_3.0.13-2_i386.deb ... Unpacking libapparmor1:i386 (3.0.13-2) ... Selecting previously unselected package libargon2-1:i386. @@ -928,7 +949,7 @@ Creating user 'systemd-network' (systemd Network Management) with UID 998 and GID 998. Setting up dmsetup (2:1.02.196-1+b1) ... Selecting previously unselected package systemd-sysv. -(Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20801 files and directories currently installed.) +(Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20977 files and directories currently installed.) Preparing to unpack .../0-systemd-sysv_255.4-1_i386.deb ... Unpacking systemd-sysv (255.4-1) ... Selecting previously unselected package libpipeline1:i386. @@ -950,7 +971,7 @@ Setting up libexpat1:i386 (2.6.2-1) ... Setting up python3.11-minimal (3.11.9-1) ... Selecting previously unselected package python3-minimal. -(Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21156 files and directories currently installed.) +(Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21332 files and directories currently installed.) Preparing to unpack .../0-python3-minimal_3.11.8-1_i386.deb ... Unpacking python3-minimal (3.11.8-1) ... Selecting previously unselected package media-types. @@ -983,7 +1004,7 @@ Unpacking libpython3-stdlib:i386 (3.11.8-1) ... Setting up python3-minimal (3.11.8-1) ... Selecting previously unselected package python3. -(Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 22148 files and directories currently installed.) +(Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 22324 files and directories currently installed.) Preparing to unpack .../000-python3_3.11.8-1_i386.deb ... Unpacking python3 (3.11.8-1) ... Selecting previously unselected package libproc2-0:i386. @@ -1346,716 +1367,698 @@ Selecting previously unselected package libavahi-client3:i386. Preparing to unpack .../120-libavahi-client3_0.8-13+b2_i386.deb ... Unpacking libavahi-client3:i386 (0.8-13+b2) ... -Selecting previously unselected package libkrb5support0:i386. -Preparing to unpack .../121-libkrb5support0_1.20.1-5+b1_i386.deb ... -Unpacking libkrb5support0:i386 (1.20.1-5+b1) ... -Selecting previously unselected package libcom-err2:i386. -Preparing to unpack .../122-libcom-err2_1.47.0-2.4_i386.deb ... -Unpacking libcom-err2:i386 (1.47.0-2.4) ... -Selecting previously unselected package libk5crypto3:i386. -Preparing to unpack .../123-libk5crypto3_1.20.1-5+b1_i386.deb ... -Unpacking libk5crypto3:i386 (1.20.1-5+b1) ... -Selecting previously unselected package libkeyutils1:i386. -Preparing to unpack .../124-libkeyutils1_1.6.3-3_i386.deb ... -Unpacking libkeyutils1:i386 (1.6.3-3) ... -Selecting previously unselected package libkrb5-3:i386. -Preparing to unpack .../125-libkrb5-3_1.20.1-5+b1_i386.deb ... -Unpacking libkrb5-3:i386 (1.20.1-5+b1) ... -Selecting previously unselected package libgssapi-krb5-2:i386. -Preparing to unpack .../126-libgssapi-krb5-2_1.20.1-5+b1_i386.deb ... -Unpacking libgssapi-krb5-2:i386 (1.20.1-5+b1) ... Selecting previously unselected package libcups2t64:i386. -Preparing to unpack .../127-libcups2t64_2.4.7-1.2+b1_i386.deb ... +Preparing to unpack .../121-libcups2t64_2.4.7-1.2+b1_i386.deb ... Unpacking libcups2t64:i386 (2.4.7-1.2+b1) ... Selecting previously unselected package libepoxy0:i386. -Preparing to unpack .../128-libepoxy0_1.5.10-1+b2_i386.deb ... +Preparing to unpack .../122-libepoxy0_1.5.10-1+b2_i386.deb ... Unpacking libepoxy0:i386 (1.5.10-1+b2) ... Selecting previously unselected package libfribidi0:i386. -Preparing to unpack .../129-libfribidi0_1.0.13-3+b1_i386.deb ... +Preparing to unpack .../123-libfribidi0_1.0.13-3+b1_i386.deb ... Unpacking libfribidi0:i386 (1.0.13-3+b1) ... Selecting previously unselected package libgraphite2-3:i386. -Preparing to unpack .../130-libgraphite2-3_1.3.14-2_i386.deb ... +Preparing to unpack .../124-libgraphite2-3_1.3.14-2_i386.deb ... Unpacking libgraphite2-3:i386 (1.3.14-2) ... Selecting previously unselected package libharfbuzz0b:i386. -Preparing to unpack .../131-libharfbuzz0b_8.3.0-2+b1_i386.deb ... +Preparing to unpack .../125-libharfbuzz0b_8.3.0-2+b1_i386.deb ... Unpacking libharfbuzz0b:i386 (8.3.0-2+b1) ... Selecting previously unselected package fontconfig. -Preparing to unpack .../132-fontconfig_2.15.0-1.1_i386.deb ... +Preparing to unpack .../126-fontconfig_2.15.0-1.1_i386.deb ... Unpacking fontconfig (2.15.0-1.1) ... Selecting previously unselected package libthai-data. -Preparing to unpack .../133-libthai-data_0.1.29-2_all.deb ... +Preparing to unpack .../127-libthai-data_0.1.29-2_all.deb ... Unpacking libthai-data (0.1.29-2) ... Selecting previously unselected package libdatrie1:i386. -Preparing to unpack .../134-libdatrie1_0.2.13-3_i386.deb ... +Preparing to unpack .../128-libdatrie1_0.2.13-3_i386.deb ... Unpacking libdatrie1:i386 (0.2.13-3) ... Selecting previously unselected package libthai0:i386. -Preparing to unpack .../135-libthai0_0.1.29-2_i386.deb ... +Preparing to unpack .../129-libthai0_0.1.29-2_i386.deb ... Unpacking libthai0:i386 (0.1.29-2) ... Selecting previously unselected package libpango-1.0-0:i386. -Preparing to unpack .../136-libpango-1.0-0_1.52.1+ds-1_i386.deb ... +Preparing to unpack .../130-libpango-1.0-0_1.52.1+ds-1_i386.deb ... Unpacking libpango-1.0-0:i386 (1.52.1+ds-1) ... Selecting previously unselected package libpangoft2-1.0-0:i386. -Preparing to unpack .../137-libpangoft2-1.0-0_1.52.1+ds-1_i386.deb ... +Preparing to unpack .../131-libpangoft2-1.0-0_1.52.1+ds-1_i386.deb ... Unpacking libpangoft2-1.0-0:i386 (1.52.1+ds-1) ... Selecting previously unselected package libpangocairo-1.0-0:i386. -Preparing to unpack .../138-libpangocairo-1.0-0_1.52.1+ds-1_i386.deb ... +Preparing to unpack .../132-libpangocairo-1.0-0_1.52.1+ds-1_i386.deb ... Unpacking libpangocairo-1.0-0:i386 (1.52.1+ds-1) ... Selecting previously unselected package libwayland-client0:i386. -Preparing to unpack .../139-libwayland-client0_1.22.0-2.1+b1_i386.deb ... +Preparing to unpack .../133-libwayland-client0_1.22.0-2.1+b1_i386.deb ... Unpacking libwayland-client0:i386 (1.22.0-2.1+b1) ... Selecting previously unselected package libwayland-cursor0:i386. -Preparing to unpack .../140-libwayland-cursor0_1.22.0-2.1+b1_i386.deb ... +Preparing to unpack .../134-libwayland-cursor0_1.22.0-2.1+b1_i386.deb ... Unpacking libwayland-cursor0:i386 (1.22.0-2.1+b1) ... Selecting previously unselected package libwayland-egl1:i386. -Preparing to unpack .../141-libwayland-egl1_1.22.0-2.1+b1_i386.deb ... +Preparing to unpack .../135-libwayland-egl1_1.22.0-2.1+b1_i386.deb ... Unpacking libwayland-egl1:i386 (1.22.0-2.1+b1) ... Selecting previously unselected package libxcomposite1:i386. -Preparing to unpack .../142-libxcomposite1_1%3a0.4.5-1+b1_i386.deb ... +Preparing to unpack .../136-libxcomposite1_1%3a0.4.5-1+b1_i386.deb ... Unpacking libxcomposite1:i386 (1:0.4.5-1+b1) ... Selecting previously unselected package libxfixes3:i386. -Preparing to unpack .../143-libxfixes3_1%3a6.0.0-2+b1_i386.deb ... +Preparing to unpack .../137-libxfixes3_1%3a6.0.0-2+b1_i386.deb ... Unpacking libxfixes3:i386 (1:6.0.0-2+b1) ... Selecting previously unselected package libxcursor1:i386. -Preparing to unpack .../144-libxcursor1_1%3a1.2.1-1+b1_i386.deb ... +Preparing to unpack .../138-libxcursor1_1%3a1.2.1-1+b1_i386.deb ... Unpacking libxcursor1:i386 (1:1.2.1-1+b1) ... Selecting previously unselected package libxdamage1:i386. -Preparing to unpack .../145-libxdamage1_1%3a1.1.6-1+b1_i386.deb ... +Preparing to unpack .../139-libxdamage1_1%3a1.1.6-1+b1_i386.deb ... Unpacking libxdamage1:i386 (1:1.1.6-1+b1) ... Selecting previously unselected package libxinerama1:i386. -Preparing to unpack .../146-libxinerama1_2%3a1.1.4-3+b1_i386.deb ... +Preparing to unpack .../140-libxinerama1_2%3a1.1.4-3+b1_i386.deb ... Unpacking libxinerama1:i386 (2:1.1.4-3+b1) ... Selecting previously unselected package xkb-data. -Preparing to unpack .../147-xkb-data_2.41-2_all.deb ... +Preparing to unpack .../141-xkb-data_2.41-2_all.deb ... Unpacking xkb-data (2.41-2) ... Selecting previously unselected package libxkbcommon0:i386. -Preparing to unpack .../148-libxkbcommon0_1.6.0-1+b1_i386.deb ... +Preparing to unpack .../142-libxkbcommon0_1.6.0-1+b1_i386.deb ... Unpacking libxkbcommon0:i386 (1.6.0-1+b1) ... Selecting previously unselected package libxrandr2:i386. -Preparing to unpack .../149-libxrandr2_2%3a1.5.4-1_i386.deb ... +Preparing to unpack .../143-libxrandr2_2%3a1.5.4-1_i386.deb ... Unpacking libxrandr2:i386 (2:1.5.4-1) ... Selecting previously unselected package libgtk-3-common. -Preparing to unpack .../150-libgtk-3-common_3.24.41-4_all.deb ... +Preparing to unpack .../144-libgtk-3-common_3.24.41-4_all.deb ... Unpacking libgtk-3-common (3.24.41-4) ... Selecting previously unselected package libgtk-3-0t64:i386. -Preparing to unpack .../151-libgtk-3-0t64_3.24.41-4_i386.deb ... +Preparing to unpack .../145-libgtk-3-0t64_3.24.41-4_i386.deb ... Unpacking libgtk-3-0t64:i386 (3.24.41-4) ... Selecting previously unselected package libglvnd0:i386. -Preparing to unpack .../152-libglvnd0_1.7.0-1+b1_i386.deb ... +Preparing to unpack .../146-libglvnd0_1.7.0-1+b1_i386.deb ... Unpacking libglvnd0:i386 (1.7.0-1+b1) ... Selecting previously unselected package libdrm-common. -Preparing to unpack .../153-libdrm-common_2.4.120-2_all.deb ... +Preparing to unpack .../147-libdrm-common_2.4.120-2_all.deb ... Unpacking libdrm-common (2.4.120-2) ... Selecting previously unselected package libdrm2:i386. -Preparing to unpack .../154-libdrm2_2.4.120-2_i386.deb ... +Preparing to unpack .../148-libdrm2_2.4.120-2_i386.deb ... Unpacking libdrm2:i386 (2.4.120-2) ... Selecting previously unselected package libglapi-mesa:i386. -Preparing to unpack .../155-libglapi-mesa_23.3.5-1_i386.deb ... +Preparing to unpack .../149-libglapi-mesa_23.3.5-1_i386.deb ... Unpacking libglapi-mesa:i386 (23.3.5-1) ... Selecting previously unselected package libx11-xcb1:i386. -Preparing to unpack .../156-libx11-xcb1_2%3a1.8.7-1+b1_i386.deb ... +Preparing to unpack .../150-libx11-xcb1_2%3a1.8.7-1+b1_i386.deb ... Unpacking libx11-xcb1:i386 (2:1.8.7-1+b1) ... Selecting previously unselected package libxcb-dri2-0:i386. -Preparing to unpack .../157-libxcb-dri2-0_1.15-1_i386.deb ... +Preparing to unpack .../151-libxcb-dri2-0_1.15-1_i386.deb ... Unpacking libxcb-dri2-0:i386 (1.15-1) ... Selecting previously unselected package libxcb-dri3-0:i386. -Preparing to unpack .../158-libxcb-dri3-0_1.15-1_i386.deb ... +Preparing to unpack .../152-libxcb-dri3-0_1.15-1_i386.deb ... Unpacking libxcb-dri3-0:i386 (1.15-1) ... Selecting previously unselected package libxcb-glx0:i386. -Preparing to unpack .../159-libxcb-glx0_1.15-1_i386.deb ... +Preparing to unpack .../153-libxcb-glx0_1.15-1_i386.deb ... Unpacking libxcb-glx0:i386 (1.15-1) ... Selecting previously unselected package libxcb-present0:i386. -Preparing to unpack .../160-libxcb-present0_1.15-1_i386.deb ... +Preparing to unpack .../154-libxcb-present0_1.15-1_i386.deb ... Unpacking libxcb-present0:i386 (1.15-1) ... Selecting previously unselected package libxcb-randr0:i386. -Preparing to unpack .../161-libxcb-randr0_1.15-1_i386.deb ... +Preparing to unpack .../155-libxcb-randr0_1.15-1_i386.deb ... Unpacking libxcb-randr0:i386 (1.15-1) ... Selecting previously unselected package libxcb-sync1:i386. -Preparing to unpack .../162-libxcb-sync1_1.15-1_i386.deb ... +Preparing to unpack .../156-libxcb-sync1_1.15-1_i386.deb ... Unpacking libxcb-sync1:i386 (1.15-1) ... Selecting previously unselected package libxcb-xfixes0:i386. -Preparing to unpack .../163-libxcb-xfixes0_1.15-1_i386.deb ... +Preparing to unpack .../157-libxcb-xfixes0_1.15-1_i386.deb ... Unpacking libxcb-xfixes0:i386 (1.15-1) ... Selecting previously unselected package libxshmfence1:i386. -Preparing to unpack .../164-libxshmfence1_1.3-1+b1_i386.deb ... +Preparing to unpack .../158-libxshmfence1_1.3-1+b1_i386.deb ... Unpacking libxshmfence1:i386 (1.3-1+b1) ... Selecting previously unselected package libxxf86vm1:i386. -Preparing to unpack .../165-libxxf86vm1_1%3a1.1.4-1+b2_i386.deb ... +Preparing to unpack .../159-libxxf86vm1_1%3a1.1.4-1+b2_i386.deb ... Unpacking libxxf86vm1:i386 (1:1.1.4-1+b2) ... Selecting previously unselected package libvulkan1:i386. -Preparing to unpack .../166-libvulkan1_1.3.280.0-1_i386.deb ... +Preparing to unpack .../160-libvulkan1_1.3.280.0-1_i386.deb ... Unpacking libvulkan1:i386 (1.3.280.0-1) ... Selecting previously unselected package libdrm-amdgpu1:i386. -Preparing to unpack .../167-libdrm-amdgpu1_2.4.120-2_i386.deb ... +Preparing to unpack .../161-libdrm-amdgpu1_2.4.120-2_i386.deb ... Unpacking libdrm-amdgpu1:i386 (2.4.120-2) ... Selecting previously unselected package libpciaccess0:i386. -Preparing to unpack .../168-libpciaccess0_0.17-3+b1_i386.deb ... +Preparing to unpack .../162-libpciaccess0_0.17-3+b1_i386.deb ... Unpacking libpciaccess0:i386 (0.17-3+b1) ... Selecting previously unselected package libdrm-intel1:i386. -Preparing to unpack .../169-libdrm-intel1_2.4.120-2_i386.deb ... +Preparing to unpack .../163-libdrm-intel1_2.4.120-2_i386.deb ... Unpacking libdrm-intel1:i386 (2.4.120-2) ... Selecting previously unselected package libdrm-nouveau2:i386. -Preparing to unpack .../170-libdrm-nouveau2_2.4.120-2_i386.deb ... +Preparing to unpack .../164-libdrm-nouveau2_2.4.120-2_i386.deb ... Unpacking libdrm-nouveau2:i386 (2.4.120-2) ... Selecting previously unselected package libdrm-radeon1:i386. -Preparing to unpack .../171-libdrm-radeon1_2.4.120-2_i386.deb ... +Preparing to unpack .../165-libdrm-radeon1_2.4.120-2_i386.deb ... Unpacking libdrm-radeon1:i386 (2.4.120-2) ... Selecting previously unselected package libedit2:i386. -Preparing to unpack .../172-libedit2_3.1-20230828-1+b1_i386.deb ... +Preparing to unpack .../166-libedit2_3.1-20230828-1+b1_i386.deb ... Unpacking libedit2:i386 (3.1-20230828-1+b1) ... Selecting previously unselected package libz3-4:i386. -Preparing to unpack .../173-libz3-4_4.8.12-3.1+b2_i386.deb ... +Preparing to unpack .../167-libz3-4_4.8.12-3.1+b2_i386.deb ... Unpacking libz3-4:i386 (4.8.12-3.1+b2) ... Selecting previously unselected package libllvm17t64:i386. -Preparing to unpack .../174-libllvm17t64_1%3a17.0.6-11_i386.deb ... +Preparing to unpack .../168-libllvm17t64_1%3a17.0.6-11_i386.deb ... Unpacking libllvm17t64:i386 (1:17.0.6-11) ... Selecting previously unselected package libsensors-config. -Preparing to unpack .../175-libsensors-config_1%3a3.6.0-9_all.deb ... +Preparing to unpack .../169-libsensors-config_1%3a3.6.0-9_all.deb ... Unpacking libsensors-config (1:3.6.0-9) ... Selecting previously unselected package libsensors5:i386. -Preparing to unpack .../176-libsensors5_1%3a3.6.0-9_i386.deb ... +Preparing to unpack .../170-libsensors5_1%3a3.6.0-9_i386.deb ... Unpacking libsensors5:i386 (1:3.6.0-9) ... Selecting previously unselected package libgl1-mesa-dri:i386. -Preparing to unpack .../177-libgl1-mesa-dri_23.3.5-1_i386.deb ... +Preparing to unpack .../171-libgl1-mesa-dri_23.3.5-1_i386.deb ... Unpacking libgl1-mesa-dri:i386 (23.3.5-1) ... Selecting previously unselected package libglx-mesa0:i386. -Preparing to unpack .../178-libglx-mesa0_23.3.5-1_i386.deb ... +Preparing to unpack .../172-libglx-mesa0_23.3.5-1_i386.deb ... Unpacking libglx-mesa0:i386 (23.3.5-1) ... Selecting previously unselected package libglx0:i386. -Preparing to unpack .../179-libglx0_1.7.0-1+b1_i386.deb ... +Preparing to unpack .../173-libglx0_1.7.0-1+b1_i386.deb ... Unpacking libglx0:i386 (1.7.0-1+b1) ... Selecting previously unselected package libgl1:i386. -Preparing to unpack .../180-libgl1_1.7.0-1+b1_i386.deb ... +Preparing to unpack .../174-libgl1_1.7.0-1+b1_i386.deb ... Unpacking libgl1:i386 (1.7.0-1+b1) ... Selecting previously unselected package libasound2-data. -Preparing to unpack .../181-libasound2-data_1.2.11-1_all.deb ... +Preparing to unpack .../175-libasound2-data_1.2.11-1_all.deb ... Unpacking libasound2-data (1.2.11-1) ... Selecting previously unselected package libasound2t64:i386. -Preparing to unpack .../182-libasound2t64_1.2.11-1+b1_i386.deb ... +Preparing to unpack .../176-libasound2t64_1.2.11-1+b1_i386.deb ... Unpacking libasound2t64:i386 (1.2.11-1+b1) ... Selecting previously unselected package libgif7:i386. -Preparing to unpack .../183-libgif7_5.2.2-1_i386.deb ... +Preparing to unpack .../177-libgif7_5.2.2-1_i386.deb ... Unpacking libgif7:i386 (5.2.2-1) ... Selecting previously unselected package libxtst6:i386. -Preparing to unpack .../184-libxtst6_2%3a1.2.3-1.1+b1_i386.deb ... +Preparing to unpack .../178-libxtst6_2%3a1.2.3-1.1+b1_i386.deb ... Unpacking libxtst6:i386 (2:1.2.3-1.1+b1) ... Selecting previously unselected package openjdk-17-jre:i386. -Preparing to unpack .../185-openjdk-17-jre_17.0.11+9-1_i386.deb ... +Preparing to unpack .../179-openjdk-17-jre_17.0.11+9-1_i386.deb ... Unpacking openjdk-17-jre:i386 (17.0.11+9-1) ... Selecting previously unselected package default-jre. -Preparing to unpack .../186-default-jre_2%3a1.17-75_i386.deb ... +Preparing to unpack .../180-default-jre_2%3a1.17-75_i386.deb ... Unpacking default-jre (2:1.17-75) ... Selecting previously unselected package openjdk-17-jdk-headless:i386. -Preparing to unpack .../187-openjdk-17-jdk-headless_17.0.11+9-1_i386.deb ... +Preparing to unpack .../181-openjdk-17-jdk-headless_17.0.11+9-1_i386.deb ... Unpacking openjdk-17-jdk-headless:i386 (17.0.11+9-1) ... Selecting previously unselected package default-jdk-headless. -Preparing to unpack .../188-default-jdk-headless_2%3a1.17-75_i386.deb ... +Preparing to unpack .../182-default-jdk-headless_2%3a1.17-75_i386.deb ... Unpacking default-jdk-headless (2:1.17-75) ... Selecting previously unselected package openjdk-17-jdk:i386. -Preparing to unpack .../189-openjdk-17-jdk_17.0.11+9-1_i386.deb ... +Preparing to unpack .../183-openjdk-17-jdk_17.0.11+9-1_i386.deb ... Unpacking openjdk-17-jdk:i386 (17.0.11+9-1) ... Selecting previously unselected package default-jdk. -Preparing to unpack .../190-default-jdk_2%3a1.17-75_i386.deb ... +Preparing to unpack .../184-default-jdk_2%3a1.17-75_i386.deb ... Unpacking default-jdk (2:1.17-75) ... Selecting previously unselected package libassuan0:i386. -Preparing to unpack .../191-libassuan0_2.5.6-1+b1_i386.deb ... +Preparing to unpack .../185-libassuan0_2.5.6-1+b1_i386.deb ... Unpacking libassuan0:i386 (2.5.6-1+b1) ... Selecting previously unselected package gpgconf. -Preparing to unpack .../192-gpgconf_2.2.40-1.1+b1_i386.deb ... +Preparing to unpack .../186-gpgconf_2.2.40-1.1+b1_i386.deb ... Unpacking gpgconf (2.2.40-1.1+b1) ... Selecting previously unselected package libksba8:i386. -Preparing to unpack .../193-libksba8_1.6.6-1_i386.deb ... +Preparing to unpack .../187-libksba8_1.6.6-1_i386.deb ... Unpacking libksba8:i386 (1.6.6-1) ... Selecting previously unselected package libsasl2-modules-db:i386. -Preparing to unpack .../194-libsasl2-modules-db_2.1.28+dfsg1-4+b1_i386.deb ... +Preparing to unpack .../188-libsasl2-modules-db_2.1.28+dfsg1-4+b1_i386.deb ... Unpacking libsasl2-modules-db:i386 (2.1.28+dfsg1-4+b1) ... Selecting previously unselected package libsasl2-2:i386. -Preparing to unpack .../195-libsasl2-2_2.1.28+dfsg1-4+b1_i386.deb ... +Preparing to unpack .../189-libsasl2-2_2.1.28+dfsg1-4+b1_i386.deb ... Unpacking libsasl2-2:i386 (2.1.28+dfsg1-4+b1) ... Selecting previously unselected package libldap-2.5-0:i386. -Preparing to unpack .../196-libldap-2.5-0_2.5.13+dfsg-5+b3_i386.deb ... +Preparing to unpack .../190-libldap-2.5-0_2.5.13+dfsg-5+b3_i386.deb ... Unpacking libldap-2.5-0:i386 (2.5.13+dfsg-5+b3) ... Selecting previously unselected package libnpth0t64:i386. -Preparing to unpack .../197-libnpth0t64_1.6-3.1_i386.deb ... +Preparing to unpack .../191-libnpth0t64_1.6-3.1_i386.deb ... Unpacking libnpth0t64:i386 (1.6-3.1) ... Selecting previously unselected package dirmngr. -Preparing to unpack .../198-dirmngr_2.2.40-1.1+b1_i386.deb ... +Preparing to unpack .../192-dirmngr_2.2.40-1.1+b1_i386.deb ... Unpacking dirmngr (2.2.40-1.1+b1) ... Selecting previously unselected package gnupg-l10n. -Preparing to unpack .../199-gnupg-l10n_2.2.40-1.1_all.deb ... +Preparing to unpack .../193-gnupg-l10n_2.2.40-1.1_all.deb ... Unpacking gnupg-l10n (2.2.40-1.1) ... Selecting previously unselected package gnupg-utils. -Preparing to unpack .../200-gnupg-utils_2.2.40-1.1+b1_i386.deb ... +Preparing to unpack .../194-gnupg-utils_2.2.40-1.1+b1_i386.deb ... Unpacking gnupg-utils (2.2.40-1.1+b1) ... Selecting previously unselected package gpg. -Preparing to unpack .../201-gpg_2.2.40-1.1+b1_i386.deb ... +Preparing to unpack .../195-gpg_2.2.40-1.1+b1_i386.deb ... Unpacking gpg (2.2.40-1.1+b1) ... Selecting previously unselected package pinentry-curses. -Preparing to unpack .../202-pinentry-curses_1.2.1-3_i386.deb ... +Preparing to unpack .../196-pinentry-curses_1.2.1-3_i386.deb ... Unpacking pinentry-curses (1.2.1-3) ... Selecting previously unselected package gpg-agent. -Preparing to unpack .../203-gpg-agent_2.2.40-1.1+b1_i386.deb ... +Preparing to unpack .../197-gpg-agent_2.2.40-1.1+b1_i386.deb ... Unpacking gpg-agent (2.2.40-1.1+b1) ... Selecting previously unselected package gpg-wks-client. -Preparing to unpack .../204-gpg-wks-client_2.2.40-1.1+b1_i386.deb ... +Preparing to unpack .../198-gpg-wks-client_2.2.40-1.1+b1_i386.deb ... Unpacking gpg-wks-client (2.2.40-1.1+b1) ... Selecting previously unselected package gpg-wks-server. -Preparing to unpack .../205-gpg-wks-server_2.2.40-1.1+b1_i386.deb ... +Preparing to unpack .../199-gpg-wks-server_2.2.40-1.1+b1_i386.deb ... Unpacking gpg-wks-server (2.2.40-1.1+b1) ... Selecting previously unselected package gpgsm. -Preparing to unpack .../206-gpgsm_2.2.40-1.1+b1_i386.deb ... +Preparing to unpack .../200-gpgsm_2.2.40-1.1+b1_i386.deb ... Unpacking gpgsm (2.2.40-1.1+b1) ... Selecting previously unselected package gnupg. -Preparing to unpack .../207-gnupg_2.2.40-1.1_all.deb ... +Preparing to unpack .../201-gnupg_2.2.40-1.1_all.deb ... Unpacking gnupg (2.2.40-1.1) ... Selecting previously unselected package libfile-dirlist-perl. -Preparing to unpack .../208-libfile-dirlist-perl_0.05-3_all.deb ... +Preparing to unpack .../202-libfile-dirlist-perl_0.05-3_all.deb ... Unpacking libfile-dirlist-perl (0.05-3) ... Selecting previously unselected package libfile-which-perl. -Preparing to unpack .../209-libfile-which-perl_1.27-2_all.deb ... +Preparing to unpack .../203-libfile-which-perl_1.27-2_all.deb ... Unpacking libfile-which-perl (1.27-2) ... Selecting previously unselected package libfile-homedir-perl. -Preparing to unpack .../210-libfile-homedir-perl_1.006-2_all.deb ... +Preparing to unpack .../204-libfile-homedir-perl_1.006-2_all.deb ... Unpacking libfile-homedir-perl (1.006-2) ... Selecting previously unselected package libfile-touch-perl. -Preparing to unpack .../211-libfile-touch-perl_0.12-2_all.deb ... +Preparing to unpack .../205-libfile-touch-perl_0.12-2_all.deb ... Unpacking libfile-touch-perl (0.12-2) ... Selecting previously unselected package libio-pty-perl. -Preparing to unpack .../212-libio-pty-perl_1%3a1.20-1_i386.deb ... +Preparing to unpack .../206-libio-pty-perl_1%3a1.20-1_i386.deb ... Unpacking libio-pty-perl (1:1.20-1) ... Selecting previously unselected package libipc-run-perl. -Preparing to unpack .../213-libipc-run-perl_20231003.0-2_all.deb ... +Preparing to unpack .../207-libipc-run-perl_20231003.0-2_all.deb ... Unpacking libipc-run-perl (20231003.0-2) ... Selecting previously unselected package libclass-method-modifiers-perl. -Preparing to unpack .../214-libclass-method-modifiers-perl_2.15-1_all.deb ... +Preparing to unpack .../208-libclass-method-modifiers-perl_2.15-1_all.deb ... Unpacking libclass-method-modifiers-perl (2.15-1) ... Selecting previously unselected package libclass-xsaccessor-perl. -Preparing to unpack .../215-libclass-xsaccessor-perl_1.19-4+b2_i386.deb ... +Preparing to unpack .../209-libclass-xsaccessor-perl_1.19-4+b2_i386.deb ... Unpacking libclass-xsaccessor-perl (1.19-4+b2) ... Selecting previously unselected package libb-hooks-op-check-perl:i386. -Preparing to unpack .../216-libb-hooks-op-check-perl_0.22-2+b2_i386.deb ... +Preparing to unpack .../210-libb-hooks-op-check-perl_0.22-2+b2_i386.deb ... Unpacking libb-hooks-op-check-perl:i386 (0.22-2+b2) ... Selecting previously unselected package libdynaloader-functions-perl. -Preparing to unpack .../217-libdynaloader-functions-perl_0.003-3_all.deb ... +Preparing to unpack .../211-libdynaloader-functions-perl_0.003-3_all.deb ... Unpacking libdynaloader-functions-perl (0.003-3) ... Selecting previously unselected package libdevel-callchecker-perl:i386. -Preparing to unpack .../218-libdevel-callchecker-perl_0.008-2+b1_i386.deb ... +Preparing to unpack .../212-libdevel-callchecker-perl_0.008-2+b1_i386.deb ... Unpacking libdevel-callchecker-perl:i386 (0.008-2+b1) ... Selecting previously unselected package libparams-classify-perl:i386. -Preparing to unpack .../219-libparams-classify-perl_0.015-2+b2_i386.deb ... +Preparing to unpack .../213-libparams-classify-perl_0.015-2+b2_i386.deb ... Unpacking libparams-classify-perl:i386 (0.015-2+b2) ... Selecting previously unselected package libmodule-runtime-perl. -Preparing to unpack .../220-libmodule-runtime-perl_0.016-2_all.deb ... +Preparing to unpack .../214-libmodule-runtime-perl_0.016-2_all.deb ... Unpacking libmodule-runtime-perl (0.016-2) ... Selecting previously unselected package libimport-into-perl. -Preparing to unpack .../221-libimport-into-perl_1.002005-2_all.deb ... +Preparing to unpack .../215-libimport-into-perl_1.002005-2_all.deb ... Unpacking libimport-into-perl (1.002005-2) ... Selecting previously unselected package librole-tiny-perl. -Preparing to unpack .../222-librole-tiny-perl_2.002004-1_all.deb ... +Preparing to unpack .../216-librole-tiny-perl_2.002004-1_all.deb ... Unpacking librole-tiny-perl (2.002004-1) ... Selecting previously unselected package libsub-quote-perl. -Preparing to unpack .../223-libsub-quote-perl_2.006008-1_all.deb ... +Preparing to unpack .../217-libsub-quote-perl_2.006008-1_all.deb ... Unpacking libsub-quote-perl (2.006008-1) ... Selecting previously unselected package libmoo-perl. -Preparing to unpack .../224-libmoo-perl_2.005005-1_all.deb ... +Preparing to unpack .../218-libmoo-perl_2.005005-1_all.deb ... Unpacking libmoo-perl (2.005005-1) ... Selecting previously unselected package libencode-locale-perl. -Preparing to unpack .../225-libencode-locale-perl_1.05-3_all.deb ... +Preparing to unpack .../219-libencode-locale-perl_1.05-3_all.deb ... Unpacking libencode-locale-perl (1.05-3) ... Selecting previously unselected package libtimedate-perl. -Preparing to unpack .../226-libtimedate-perl_2.3300-2_all.deb ... +Preparing to unpack .../220-libtimedate-perl_2.3300-2_all.deb ... Unpacking libtimedate-perl (2.3300-2) ... Selecting previously unselected package libhttp-date-perl. -Preparing to unpack .../227-libhttp-date-perl_6.06-1_all.deb ... +Preparing to unpack .../221-libhttp-date-perl_6.06-1_all.deb ... Unpacking libhttp-date-perl (6.06-1) ... Selecting previously unselected package libfile-listing-perl. -Preparing to unpack .../228-libfile-listing-perl_6.16-1_all.deb ... +Preparing to unpack .../222-libfile-listing-perl_6.16-1_all.deb ... Unpacking libfile-listing-perl (6.16-1) ... Selecting previously unselected package libhtml-tagset-perl. -Preparing to unpack .../229-libhtml-tagset-perl_3.24-1_all.deb ... +Preparing to unpack .../223-libhtml-tagset-perl_3.24-1_all.deb ... Unpacking libhtml-tagset-perl (3.24-1) ... Selecting previously unselected package liburi-perl. -Preparing to unpack .../230-liburi-perl_5.28-1_all.deb ... +Preparing to unpack .../224-liburi-perl_5.28-1_all.deb ... Unpacking liburi-perl (5.28-1) ... Selecting previously unselected package libhtml-parser-perl:i386. -Preparing to unpack .../231-libhtml-parser-perl_3.81-1+b1_i386.deb ... +Preparing to unpack .../225-libhtml-parser-perl_3.81-1+b1_i386.deb ... Unpacking libhtml-parser-perl:i386 (3.81-1+b1) ... Selecting previously unselected package libhtml-tree-perl. -Preparing to unpack .../232-libhtml-tree-perl_5.07-3_all.deb ... +Preparing to unpack .../226-libhtml-tree-perl_5.07-3_all.deb ... Unpacking libhtml-tree-perl (5.07-3) ... Selecting previously unselected package libclone-perl:i386. -Preparing to unpack .../233-libclone-perl_0.46-1+b1_i386.deb ... +Preparing to unpack .../227-libclone-perl_0.46-1+b1_i386.deb ... Unpacking libclone-perl:i386 (0.46-1+b1) ... Selecting previously unselected package libio-html-perl. -Preparing to unpack .../234-libio-html-perl_1.004-3_all.deb ... +Preparing to unpack .../228-libio-html-perl_1.004-3_all.deb ... Unpacking libio-html-perl (1.004-3) ... Selecting previously unselected package liblwp-mediatypes-perl. -Preparing to unpack .../235-liblwp-mediatypes-perl_6.04-2_all.deb ... +Preparing to unpack .../229-liblwp-mediatypes-perl_6.04-2_all.deb ... Unpacking liblwp-mediatypes-perl (6.04-2) ... Selecting previously unselected package libhttp-message-perl. -Preparing to unpack .../236-libhttp-message-perl_6.45-1_all.deb ... +Preparing to unpack .../230-libhttp-message-perl_6.45-1_all.deb ... Unpacking libhttp-message-perl (6.45-1) ... Selecting previously unselected package libhttp-cookies-perl. -Preparing to unpack .../237-libhttp-cookies-perl_6.11-1_all.deb ... +Preparing to unpack .../231-libhttp-cookies-perl_6.11-1_all.deb ... Unpacking libhttp-cookies-perl (6.11-1) ... Selecting previously unselected package libhttp-negotiate-perl. -Preparing to unpack .../238-libhttp-negotiate-perl_6.01-2_all.deb ... +Preparing to unpack .../232-libhttp-negotiate-perl_6.01-2_all.deb ... Unpacking libhttp-negotiate-perl (6.01-2) ... Selecting previously unselected package perl-openssl-defaults:i386. -Preparing to unpack .../239-perl-openssl-defaults_7+b2_i386.deb ... +Preparing to unpack .../233-perl-openssl-defaults_7+b2_i386.deb ... Unpacking perl-openssl-defaults:i386 (7+b2) ... Selecting previously unselected package libnet-ssleay-perl:i386. -Preparing to unpack .../240-libnet-ssleay-perl_1.94-1_i386.deb ... +Preparing to unpack .../234-libnet-ssleay-perl_1.94-1_i386.deb ... Unpacking libnet-ssleay-perl:i386 (1.94-1) ... Selecting previously unselected package libio-socket-ssl-perl. -Preparing to unpack .../241-libio-socket-ssl-perl_2.085-1_all.deb ... +Preparing to unpack .../235-libio-socket-ssl-perl_2.085-1_all.deb ... Unpacking libio-socket-ssl-perl (2.085-1) ... Selecting previously unselected package libnet-http-perl. -Preparing to unpack .../242-libnet-http-perl_6.23-1_all.deb ... +Preparing to unpack .../236-libnet-http-perl_6.23-1_all.deb ... Unpacking libnet-http-perl (6.23-1) ... Selecting previously unselected package liblwp-protocol-https-perl. -Preparing to unpack .../243-liblwp-protocol-https-perl_6.14-1_all.deb ... +Preparing to unpack .../237-liblwp-protocol-https-perl_6.14-1_all.deb ... Unpacking liblwp-protocol-https-perl (6.14-1) ... Selecting previously unselected package libtry-tiny-perl. -Preparing to unpack .../244-libtry-tiny-perl_0.31-2_all.deb ... +Preparing to unpack .../238-libtry-tiny-perl_0.31-2_all.deb ... Unpacking libtry-tiny-perl (0.31-2) ... Selecting previously unselected package libwww-robotrules-perl. -Preparing to unpack .../245-libwww-robotrules-perl_6.02-1_all.deb ... +Preparing to unpack .../239-libwww-robotrules-perl_6.02-1_all.deb ... Unpacking libwww-robotrules-perl (6.02-1) ... Selecting previously unselected package libwww-perl. -Preparing to unpack .../246-libwww-perl_6.77-1_all.deb ... +Preparing to unpack .../240-libwww-perl_6.77-1_all.deb ... Unpacking libwww-perl (6.77-1) ... Selecting previously unselected package patchutils. -Preparing to unpack .../247-patchutils_0.4.2-1_i386.deb ... +Preparing to unpack .../241-patchutils_0.4.2-1_i386.deb ... Unpacking patchutils (0.4.2-1) ... Selecting previously unselected package wdiff. -Preparing to unpack .../248-wdiff_1.2.2-6_i386.deb ... +Preparing to unpack .../242-wdiff_1.2.2-6_i386.deb ... Unpacking wdiff (1.2.2-6) ... Selecting previously unselected package devscripts. -Preparing to unpack .../249-devscripts_2.23.7_all.deb ... +Preparing to unpack .../243-devscripts_2.23.7_all.deb ... Unpacking devscripts (2.23.7) ... Selecting previously unselected package fastjar. -Preparing to unpack .../250-fastjar_2%3a0.98-7_i386.deb ... +Preparing to unpack .../244-fastjar_2%3a0.98-7_i386.deb ... Unpacking fastjar (2:0.98-7) ... Selecting previously unselected package ivy. -Preparing to unpack .../251-ivy_2.5.2-1_all.deb ... +Preparing to unpack .../245-ivy_2.5.2-1_all.deb ... Unpacking ivy (2.5.2-1) ... Selecting previously unselected package libasm-java. -Preparing to unpack .../252-libasm-java_9.7-1_all.deb ... +Preparing to unpack .../246-libasm-java_9.7-1_all.deb ... Unpacking libasm-java (9.7-1) ... Selecting previously unselected package libbsf-java. -Preparing to unpack .../253-libbsf-java_1%3a2.4.0-8_all.deb ... +Preparing to unpack .../247-libbsf-java_1%3a2.4.0-8_all.deb ... Unpacking libbsf-java (1:2.4.0-8) ... Selecting previously unselected package libcommons-cli-java. -Preparing to unpack .../254-libcommons-cli-java_1.6.0-1_all.deb ... +Preparing to unpack .../248-libcommons-cli-java_1.6.0-1_all.deb ... Unpacking libcommons-cli-java (1.6.0-1) ... Selecting previously unselected package libapache-pom-java. -Preparing to unpack .../255-libapache-pom-java_29-2_all.deb ... +Preparing to unpack .../249-libapache-pom-java_29-2_all.deb ... Unpacking libapache-pom-java (29-2) ... Selecting previously unselected package libcommons-parent-java. -Preparing to unpack .../256-libcommons-parent-java_56-1_all.deb ... +Preparing to unpack .../250-libcommons-parent-java_56-1_all.deb ... Unpacking libcommons-parent-java (56-1) ... Selecting previously unselected package libcommons-logging-java. -Preparing to unpack .../257-libcommons-logging-java_1.3.0-1_all.deb ... +Preparing to unpack .../251-libcommons-logging-java_1.3.0-1_all.deb ... Unpacking libcommons-logging-java (1.3.0-1) ... Selecting previously unselected package libjansi-java. -Preparing to unpack .../258-libjansi-java_2.4.1-2_all.deb ... +Preparing to unpack .../252-libjansi-java_2.4.1-2_all.deb ... Unpacking libjansi-java (2.4.1-2) ... Selecting previously unselected package libjsp-api-java. -Preparing to unpack .../259-libjsp-api-java_2.3.4-3_all.deb ... +Preparing to unpack .../253-libjsp-api-java_2.3.4-3_all.deb ... Unpacking libjsp-api-java (2.3.4-3) ... Selecting previously unselected package libqdox-java. -Preparing to unpack .../260-libqdox-java_1.12.1-3_all.deb ... +Preparing to unpack .../254-libqdox-java_1.12.1-3_all.deb ... Unpacking libqdox-java (1.12.1-3) ... Selecting previously unselected package libservlet-api-java. -Preparing to unpack .../261-libservlet-api-java_4.0.1-2_all.deb ... +Preparing to unpack .../255-libservlet-api-java_4.0.1-2_all.deb ... Unpacking libservlet-api-java (4.0.1-2) ... Selecting previously unselected package libxpp3-java. -Preparing to unpack .../262-libxpp3-java_1.1.4c-3_all.deb ... +Preparing to unpack .../256-libxpp3-java_1.1.4c-3_all.deb ... Unpacking libxpp3-java (1.1.4c-3) ... Selecting previously unselected package libxstream-java. -Preparing to unpack .../263-libxstream-java_1.4.20-1_all.deb ... +Preparing to unpack .../257-libxstream-java_1.4.20-1_all.deb ... Unpacking libxstream-java (1.4.20-1) ... Selecting previously unselected package groovy. -Preparing to unpack .../264-groovy_2.4.21-10_all.deb ... +Preparing to unpack .../258-groovy_2.4.21-10_all.deb ... Unpacking groovy (2.4.21-10) ... Selecting previously unselected package libatinject-jsr330-api-java. -Preparing to unpack .../265-libatinject-jsr330-api-java_1.0+ds1-5_all.deb ... +Preparing to unpack .../259-libatinject-jsr330-api-java_1.0+ds1-5_all.deb ... Unpacking libatinject-jsr330-api-java (1.0+ds1-5) ... Selecting previously unselected package libcommons-collections3-java. -Preparing to unpack .../266-libcommons-collections3-java_3.2.2-3_all.deb ... +Preparing to unpack .../260-libcommons-collections3-java_3.2.2-3_all.deb ... Unpacking libcommons-collections3-java (3.2.2-3) ... Selecting previously unselected package libcommons-compress-java. -Preparing to unpack .../267-libcommons-compress-java_1.25.0-1_all.deb ... +Preparing to unpack .../261-libcommons-compress-java_1.25.0-1_all.deb ... Unpacking libcommons-compress-java (1.25.0-1) ... Selecting previously unselected package libcommons-io-java. -Preparing to unpack .../268-libcommons-io-java_2.16.0-1_all.deb ... +Preparing to unpack .../262-libcommons-io-java_2.16.0-1_all.deb ... Unpacking libcommons-io-java (2.16.0-1) ... Selecting previously unselected package libcommons-lang-java. -Preparing to unpack .../269-libcommons-lang-java_2.6-10_all.deb ... +Preparing to unpack .../263-libcommons-lang-java_2.6-10_all.deb ... Unpacking libcommons-lang-java (2.6-10) ... Selecting previously unselected package liberror-prone-java. -Preparing to unpack .../270-liberror-prone-java_2.18.0-1_all.deb ... +Preparing to unpack .../264-liberror-prone-java_2.18.0-1_all.deb ... Unpacking liberror-prone-java (2.18.0-1) ... Selecting previously unselected package libjsr305-java. -Preparing to unpack .../271-libjsr305-java_0.1~+svn49-11_all.deb ... +Preparing to unpack .../265-libjsr305-java_0.1~+svn49-11_all.deb ... Unpacking libjsr305-java (0.1~+svn49-11) ... Selecting previously unselected package libguava-java. -Preparing to unpack .../272-libguava-java_32.0.1-1_all.deb ... +Preparing to unpack .../266-libguava-java_32.0.1-1_all.deb ... Unpacking libguava-java (32.0.1-1) ... Selecting previously unselected package libcommons-codec-java. -Preparing to unpack .../273-libcommons-codec-java_1.16.0-1_all.deb ... +Preparing to unpack .../267-libcommons-codec-java_1.16.0-1_all.deb ... Unpacking libcommons-codec-java (1.16.0-1) ... Selecting previously unselected package libhttpcore-java. -Preparing to unpack .../274-libhttpcore-java_4.4.16-1_all.deb ... +Preparing to unpack .../268-libhttpcore-java_4.4.16-1_all.deb ... Unpacking libhttpcore-java (4.4.16-1) ... Selecting previously unselected package libhttpclient-java. -Preparing to unpack .../275-libhttpclient-java_4.5.14-1_all.deb ... +Preparing to unpack .../269-libhttpclient-java_4.5.14-1_all.deb ... Unpacking libhttpclient-java (4.5.14-1) ... Selecting previously unselected package libjarjar-java. -Preparing to unpack .../276-libjarjar-java_1.4+svn142-12_all.deb ... +Preparing to unpack .../270-libjarjar-java_1.4+svn142-12_all.deb ... Unpacking libjarjar-java (1.4+svn142-12) ... Selecting previously unselected package libjcip-annotations-java. -Preparing to unpack .../277-libjcip-annotations-java_20060626-6_all.deb ... +Preparing to unpack .../271-libjcip-annotations-java_20060626-6_all.deb ... Unpacking libjcip-annotations-java (20060626-6) ... Selecting previously unselected package libjna-jni. -Preparing to unpack .../278-libjna-jni_5.14.0-1_i386.deb ... +Preparing to unpack .../272-libjna-jni_5.14.0-1_i386.deb ... Unpacking libjna-jni (5.14.0-1) ... Selecting previously unselected package libjna-java. -Preparing to unpack .../279-libjna-java_5.14.0-1_all.deb ... +Preparing to unpack .../273-libjna-java_5.14.0-1_all.deb ... Unpacking libjna-java (5.14.0-1) ... Selecting previously unselected package libjzlib-java. -Preparing to unpack .../280-libjzlib-java_1.1.3-3_all.deb ... +Preparing to unpack .../274-libjzlib-java_1.1.3-3_all.deb ... Unpacking libjzlib-java (1.1.3-3) ... Selecting previously unselected package libjsch-java. -Preparing to unpack .../281-libjsch-java_0.1.55-1_all.deb ... +Preparing to unpack .../275-libjsch-java_0.1.55-1_all.deb ... Unpacking libjsch-java (0.1.55-1) ... Selecting previously unselected package libminlog-java. -Preparing to unpack .../282-libminlog-java_1.3.0-1.1_all.deb ... +Preparing to unpack .../276-libminlog-java_1.3.0-1.1_all.deb ... Unpacking libminlog-java (1.3.0-1.1) ... Selecting previously unselected package libobjenesis-java. -Preparing to unpack .../283-libobjenesis-java_3.3-3_all.deb ... +Preparing to unpack .../277-libobjenesis-java_3.3-3_all.deb ... Unpacking libobjenesis-java (3.3-3) ... Selecting previously unselected package libreflectasm-java. -Preparing to unpack .../284-libreflectasm-java_1.11.9+dfsg-4_all.deb ... +Preparing to unpack .../278-libreflectasm-java_1.11.9+dfsg-4_all.deb ... Unpacking libreflectasm-java (1.11.9+dfsg-4) ... Selecting previously unselected package libkryo-java. -Preparing to unpack .../285-libkryo-java_2.20-7_all.deb ... +Preparing to unpack .../279-libkryo-java_2.20-7_all.deb ... Unpacking libkryo-java (2.20-7) ... Selecting previously unselected package liblogback-java. -Preparing to unpack .../286-liblogback-java_1%3a1.2.11-5_all.deb ... +Preparing to unpack .../280-liblogback-java_1%3a1.2.11-5_all.deb ... Unpacking liblogback-java (1:1.2.11-5) ... Selecting previously unselected package libnative-platform-jni. -Preparing to unpack .../287-libnative-platform-jni_0.14-6_i386.deb ... +Preparing to unpack .../281-libnative-platform-jni_0.14-6_i386.deb ... Unpacking libnative-platform-jni (0.14-6) ... Selecting previously unselected package libnative-platform-java. -Preparing to unpack .../288-libnative-platform-java_0.14-6_all.deb ... +Preparing to unpack .../282-libnative-platform-java_0.14-6_all.deb ... Unpacking libnative-platform-java (0.14-6) ... Selecting previously unselected package libxml-commons-external-java. -Preparing to unpack .../289-libxml-commons-external-java_1.4.01-6_all.deb ... +Preparing to unpack .../283-libxml-commons-external-java_1.4.01-6_all.deb ... Unpacking libxml-commons-external-java (1.4.01-6) ... Selecting previously unselected package libxml-commons-resolver1.1-java. -Preparing to unpack .../290-libxml-commons-resolver1.1-java_1.2-11_all.deb ... +Preparing to unpack .../284-libxml-commons-resolver1.1-java_1.2-11_all.deb ... Unpacking libxml-commons-resolver1.1-java (1.2-11) ... Selecting previously unselected package libxerces2-java. -Preparing to unpack .../291-libxerces2-java_2.12.2-1_all.deb ... +Preparing to unpack .../285-libxerces2-java_2.12.2-1_all.deb ... Unpacking libxerces2-java (2.12.2-1) ... Selecting previously unselected package libnekohtml-java. -Preparing to unpack .../292-libnekohtml-java_1.9.22.noko2-0.1_all.deb ... +Preparing to unpack .../286-libnekohtml-java_1.9.22.noko2-0.1_all.deb ... Unpacking libnekohtml-java (1.9.22.noko2-0.1) ... Selecting previously unselected package libxbean-reflect-java. -Preparing to unpack .../293-libxbean-reflect-java_4.5-8_all.deb ... +Preparing to unpack .../287-libxbean-reflect-java_4.5-8_all.deb ... Unpacking libxbean-reflect-java (4.5-8) ... Selecting previously unselected package libgradle-core-java. -Preparing to unpack .../294-libgradle-core-java_4.4.1-20_all.deb ... +Preparing to unpack .../288-libgradle-core-java_4.4.1-20_all.deb ... Unpacking libgradle-core-java (4.4.1-20) ... Selecting previously unselected package libbcprov-java. -Preparing to unpack .../295-libbcprov-java_1.77-1_all.deb ... +Preparing to unpack .../289-libbcprov-java_1.77-1_all.deb ... Unpacking libbcprov-java (1.77-1) ... Selecting previously unselected package libbcpg-java. -Preparing to unpack .../296-libbcpg-java_1.77-1_all.deb ... +Preparing to unpack .../290-libbcpg-java_1.77-1_all.deb ... Unpacking libbcpg-java (1.77-1) ... Selecting previously unselected package libbsh-java. -Preparing to unpack .../297-libbsh-java_2.0b4-20_all.deb ... +Preparing to unpack .../291-libbsh-java_2.0b4-20_all.deb ... Unpacking libbsh-java (2.0b4-20) ... Selecting previously unselected package libdd-plist-java. -Preparing to unpack .../298-libdd-plist-java_1.20-1.1_all.deb ... +Preparing to unpack .../292-libdd-plist-java_1.20-1.1_all.deb ... Unpacking libdd-plist-java (1.20-1.1) ... Selecting previously unselected package libjaxen-java. -Preparing to unpack .../299-libjaxen-java_1.1.6-4_all.deb ... +Preparing to unpack .../293-libjaxen-java_1.1.6-4_all.deb ... Unpacking libjaxen-java (1.1.6-4) ... Selecting previously unselected package libdom4j-java. -Preparing to unpack .../300-libdom4j-java_2.1.4-1_all.deb ... +Preparing to unpack .../294-libdom4j-java_2.1.4-1_all.deb ... Unpacking libdom4j-java (2.1.4-1) ... Selecting previously unselected package libbcel-java. -Preparing to unpack .../301-libbcel-java_6.5.0-2_all.deb ... +Preparing to unpack .../295-libbcel-java_6.5.0-2_all.deb ... Unpacking libbcel-java (6.5.0-2) ... Selecting previously unselected package libjformatstring-java. -Preparing to unpack .../302-libjformatstring-java_0.10~20131207-2.1_all.deb ... +Preparing to unpack .../296-libjformatstring-java_0.10~20131207-2.1_all.deb ... Unpacking libjformatstring-java (0.10~20131207-2.1) ... Selecting previously unselected package libfindbugs-java. -Preparing to unpack .../303-libfindbugs-java_3.1.0~preview2-3_all.deb ... +Preparing to unpack .../297-libfindbugs-java_3.1.0~preview2-3_all.deb ... Unpacking libfindbugs-java (3.1.0~preview2-3) ... Selecting previously unselected package libgoogle-gson-java. -Preparing to unpack .../304-libgoogle-gson-java_2.10.1-1_all.deb ... +Preparing to unpack .../298-libgoogle-gson-java_2.10.1-1_all.deb ... Unpacking libgoogle-gson-java (2.10.1-1) ... Selecting previously unselected package libaopalliance-java. -Preparing to unpack .../305-libaopalliance-java_20070526-7_all.deb ... +Preparing to unpack .../299-libaopalliance-java_20070526-7_all.deb ... Unpacking libaopalliance-java (20070526-7) ... Selecting previously unselected package libguice-java. -Preparing to unpack .../306-libguice-java_4.2.3-2_all.deb ... +Preparing to unpack .../300-libguice-java_4.2.3-2_all.deb ... Unpacking libguice-java (4.2.3-2) ... Selecting previously unselected package libjatl-java. -Preparing to unpack .../307-libjatl-java_0.2.3-1.1_all.deb ... +Preparing to unpack .../301-libjatl-java_0.2.3-1.1_all.deb ... Unpacking libjatl-java (0.2.3-1.1) ... Selecting previously unselected package libjcifs-java. -Preparing to unpack .../308-libjcifs-java_1.3.19-2_all.deb ... +Preparing to unpack .../302-libjcifs-java_1.3.19-2_all.deb ... Unpacking libjcifs-java (1.3.19-2) ... Selecting previously unselected package libeclipse-jdt-annotation-java. -Preparing to unpack .../309-libeclipse-jdt-annotation-java_2.2.700+eclipse4.26-2_all.deb ... +Preparing to unpack .../303-libeclipse-jdt-annotation-java_2.2.700+eclipse4.26-2_all.deb ... Unpacking libeclipse-jdt-annotation-java (2.2.700+eclipse4.26-2) ... Selecting previously unselected package libjavaewah-java. -Preparing to unpack .../310-libjavaewah-java_1.2.3-1_all.deb ... +Preparing to unpack .../304-libjavaewah-java_1.2.3-1_all.deb ... Unpacking libjavaewah-java (1.2.3-1) ... Selecting previously unselected package libel-api-java. -Preparing to unpack .../311-libel-api-java_3.0.0-3_all.deb ... +Preparing to unpack .../305-libel-api-java_3.0.0-3_all.deb ... Unpacking libel-api-java (3.0.0-3) ... Selecting previously unselected package libwebsocket-api-java. -Preparing to unpack .../312-libwebsocket-api-java_1.1-2_all.deb ... +Preparing to unpack .../306-libwebsocket-api-java_1.1-2_all.deb ... Unpacking libwebsocket-api-java (1.1-2) ... Selecting previously unselected package libjetty9-java. -Preparing to unpack .../313-libjetty9-java_9.4.54-1_all.deb ... +Preparing to unpack .../307-libjetty9-java_9.4.54-1_all.deb ... Unpacking libjetty9-java (9.4.54-1) ... Selecting previously unselected package libjgit-java. -Preparing to unpack .../314-libjgit-java_4.11.9-2_all.deb ... +Preparing to unpack .../308-libjgit-java_4.11.9-2_all.deb ... Unpacking libjgit-java (4.11.9-2) ... Selecting previously unselected package libjs-jquery. -Preparing to unpack .../315-libjs-jquery_3.6.1+dfsg+~3.5.14-1_all.deb ... +Preparing to unpack .../309-libjs-jquery_3.6.1+dfsg+~3.5.14-1_all.deb ... Unpacking libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... Selecting previously unselected package libcommons-lang3-java. -Preparing to unpack .../316-libcommons-lang3-java_3.14.0-1_all.deb ... +Preparing to unpack .../310-libcommons-lang3-java_3.14.0-1_all.deb ... Unpacking libcommons-lang3-java (3.14.0-1) ... Selecting previously unselected package libplexus-utils2-java. -Preparing to unpack .../317-libplexus-utils2-java_3.4.2-1_all.deb ... +Preparing to unpack .../311-libplexus-utils2-java_3.4.2-1_all.deb ... Unpacking libplexus-utils2-java (3.4.2-1) ... Selecting previously unselected package libwagon-provider-api-java. -Preparing to unpack .../318-libwagon-provider-api-java_3.5.3-1_all.deb ... +Preparing to unpack .../312-libwagon-provider-api-java_3.5.3-1_all.deb ... Unpacking libwagon-provider-api-java (3.5.3-1) ... Selecting previously unselected package libmaven-resolver-java. -Preparing to unpack .../319-libmaven-resolver-java_1.6.3-1_all.deb ... +Preparing to unpack .../313-libmaven-resolver-java_1.6.3-1_all.deb ... Unpacking libmaven-resolver-java (1.6.3-1) ... Selecting previously unselected package libgeronimo-annotation-1.3-spec-java. -Preparing to unpack .../320-libgeronimo-annotation-1.3-spec-java_1.3-1_all.deb ... +Preparing to unpack .../314-libgeronimo-annotation-1.3-spec-java_1.3-1_all.deb ... Unpacking libgeronimo-annotation-1.3-spec-java (1.3-1) ... Selecting previously unselected package libmaven-parent-java. -Preparing to unpack .../321-libmaven-parent-java_35-1_all.deb ... +Preparing to unpack .../315-libmaven-parent-java_35-1_all.deb ... Unpacking libmaven-parent-java (35-1) ... Selecting previously unselected package libmaven-shared-utils-java. -Preparing to unpack .../322-libmaven-shared-utils-java_3.3.4-1_all.deb ... +Preparing to unpack .../316-libmaven-shared-utils-java_3.3.4-1_all.deb ... Unpacking libmaven-shared-utils-java (3.3.4-1) ... Selecting previously unselected package libplexus-cipher-java. -Preparing to unpack .../323-libplexus-cipher-java_2.0-1_all.deb ... +Preparing to unpack .../317-libplexus-cipher-java_2.0-1_all.deb ... Unpacking libplexus-cipher-java (2.0-1) ... Selecting previously unselected package libplexus-classworlds-java. -Preparing to unpack .../324-libplexus-classworlds-java_2.7.0-1_all.deb ... +Preparing to unpack .../318-libplexus-classworlds-java_2.7.0-1_all.deb ... Unpacking libplexus-classworlds-java (2.7.0-1) ... Selecting previously unselected package libplexus-component-annotations-java. -Preparing to unpack .../325-libplexus-component-annotations-java_2.1.1-1_all.deb ... +Preparing to unpack .../319-libplexus-component-annotations-java_2.1.1-1_all.deb ... Unpacking libplexus-component-annotations-java (2.1.1-1) ... Selecting previously unselected package libplexus-interpolation-java. -Preparing to unpack .../326-libplexus-interpolation-java_1.26-1_all.deb ... +Preparing to unpack .../320-libplexus-interpolation-java_1.26-1_all.deb ... Unpacking libplexus-interpolation-java (1.26-1) ... Selecting previously unselected package libplexus-sec-dispatcher-java. -Preparing to unpack .../327-libplexus-sec-dispatcher-java_2.0-3_all.deb ... +Preparing to unpack .../321-libplexus-sec-dispatcher-java_2.0-3_all.deb ... Unpacking libplexus-sec-dispatcher-java (2.0-3) ... Selecting previously unselected package libgeronimo-interceptor-3.0-spec-java. -Preparing to unpack .../328-libgeronimo-interceptor-3.0-spec-java_1.0.1-4_all.deb ... +Preparing to unpack .../322-libgeronimo-interceptor-3.0-spec-java_1.0.1-4_all.deb ... Unpacking libgeronimo-interceptor-3.0-spec-java (1.0.1-4) ... Selecting previously unselected package libcdi-api-java. -Preparing to unpack .../329-libcdi-api-java_1.2-3_all.deb ... +Preparing to unpack .../323-libcdi-api-java_1.2-3_all.deb ... Unpacking libcdi-api-java (1.2-3) ... Selecting previously unselected package libsisu-inject-java. -Preparing to unpack .../330-libsisu-inject-java_0.3.4-2_all.deb ... +Preparing to unpack .../324-libsisu-inject-java_0.3.4-2_all.deb ... Unpacking libsisu-inject-java (0.3.4-2) ... Selecting previously unselected package libsisu-plexus-java. -Preparing to unpack .../331-libsisu-plexus-java_0.3.4-3_all.deb ... +Preparing to unpack .../325-libsisu-plexus-java_0.3.4-3_all.deb ... Unpacking libsisu-plexus-java (0.3.4-3) ... Selecting previously unselected package libmaven3-core-java. -Preparing to unpack .../332-libmaven3-core-java_3.8.7-2_all.deb ... +Preparing to unpack .../326-libmaven3-core-java_3.8.7-2_all.deb ... Unpacking libmaven3-core-java (3.8.7-2) ... Selecting previously unselected package libplexus-container-default-java. -Preparing to unpack .../333-libplexus-container-default-java_2.1.1-1_all.deb ... +Preparing to unpack .../327-libplexus-container-default-java_2.1.1-1_all.deb ... Unpacking libplexus-container-default-java (2.1.1-1) ... Selecting previously unselected package libpolyglot-maven-java. -Preparing to unpack .../334-libpolyglot-maven-java_0.8~tobrien+git20120905-10_all.deb ... +Preparing to unpack .../328-libpolyglot-maven-java_0.8~tobrien+git20120905-10_all.deb ... Unpacking libpolyglot-maven-java (0.8~tobrien+git20120905-10) ... Selecting previously unselected package librhino-java. -Preparing to unpack .../335-librhino-java_1.7.14-2.1_all.deb ... +Preparing to unpack .../329-librhino-java_1.7.14-2.1_all.deb ... Unpacking librhino-java (1.7.14-2.1) ... Selecting previously unselected package libsimple-http-java. -Preparing to unpack .../336-libsimple-http-java_4.1.21-1.1_all.deb ... +Preparing to unpack .../330-libsimple-http-java_4.1.21-1.1_all.deb ... Unpacking libsimple-http-java (4.1.21-1.1) ... Selecting previously unselected package libwagon-file-java. -Preparing to unpack .../337-libwagon-file-java_3.5.3-1_all.deb ... +Preparing to unpack .../331-libwagon-file-java_3.5.3-1_all.deb ... Unpacking libwagon-file-java (3.5.3-1) ... Selecting previously unselected package libjsoup-java. -Preparing to unpack .../338-libjsoup-java_1.15.3-1_all.deb ... +Preparing to unpack .../332-libjsoup-java_1.15.3-1_all.deb ... Unpacking libjsoup-java (1.15.3-1) ... Selecting previously unselected package libwagon-http-java. -Preparing to unpack .../339-libwagon-http-java_3.5.3-1_all.deb ... +Preparing to unpack .../333-libwagon-http-java_3.5.3-1_all.deb ... Unpacking libwagon-http-java (3.5.3-1) ... Selecting previously unselected package libjcommander-java. -Preparing to unpack .../340-libjcommander-java_1.71-4_all.deb ... +Preparing to unpack .../334-libjcommander-java_1.71-4_all.deb ... Unpacking libjcommander-java (1.71-4) ... Selecting previously unselected package testng. -Preparing to unpack .../341-testng_6.9.12-4_all.deb ... +Preparing to unpack .../335-testng_6.9.12-4_all.deb ... Unpacking testng (6.9.12-4) ... Selecting previously unselected package libgradle-plugins-java. -Preparing to unpack .../342-libgradle-plugins-java_4.4.1-20_all.deb ... +Preparing to unpack .../336-libgradle-plugins-java_4.4.1-20_all.deb ... Unpacking libgradle-plugins-java (4.4.1-20) ... Selecting previously unselected package gradle. -Preparing to unpack .../343-gradle_4.4.1-20_all.deb ... +Preparing to unpack .../337-gradle_4.4.1-20_all.deb ... Unpacking gradle (4.4.1-20) ... Selecting previously unselected package maven-repo-helper. -Preparing to unpack .../344-maven-repo-helper_1.11_all.deb ... +Preparing to unpack .../338-maven-repo-helper_1.11_all.deb ... Unpacking maven-repo-helper (1.11) ... Selecting previously unselected package gradle-debian-helper. -Preparing to unpack .../345-gradle-debian-helper_2.4_all.deb ... +Preparing to unpack .../339-gradle-debian-helper_2.4_all.deb ... Unpacking gradle-debian-helper (2.4) ... Selecting previously unselected package jarwrapper. -Preparing to unpack .../346-jarwrapper_0.79_all.deb ... +Preparing to unpack .../340-jarwrapper_0.79_all.deb ... Unpacking jarwrapper (0.79) ... Selecting previously unselected package javahelper. -Preparing to unpack .../347-javahelper_0.79_all.deb ... +Preparing to unpack .../341-javahelper_0.79_all.deb ... Unpacking javahelper (0.79) ... Selecting previously unselected package libbyte-buddy-java. -Preparing to unpack .../348-libbyte-buddy-java_1.14.13-1_all.deb ... +Preparing to unpack .../342-libbyte-buddy-java_1.14.13-1_all.deb ... Unpacking libbyte-buddy-java (1.14.13-1) ... Selecting previously unselected package libcommons-math3-java. -Preparing to unpack .../349-libcommons-math3-java_3.6.1-3_all.deb ... +Preparing to unpack .../343-libcommons-math3-java_3.6.1-3_all.deb ... Unpacking libcommons-math3-java (3.6.1-3) ... Selecting previously unselected package libjackson2-annotations-java. -Preparing to unpack .../350-libjackson2-annotations-java_2.14.0-1_all.deb ... +Preparing to unpack .../344-libjackson2-annotations-java_2.14.0-1_all.deb ... Unpacking libjackson2-annotations-java (2.14.0-1) ... Selecting previously unselected package libjackson2-core-java. -Preparing to unpack .../351-libjackson2-core-java_2.14.1-1_all.deb ... +Preparing to unpack .../345-libjackson2-core-java_2.14.1-1_all.deb ... Unpacking libjackson2-core-java (2.14.1-1) ... Selecting previously unselected package libjackson2-databind-java. -Preparing to unpack .../352-libjackson2-databind-java_2.14.0-1_all.deb ... +Preparing to unpack .../346-libjackson2-databind-java_2.14.0-1_all.deb ... Unpacking libjackson2-databind-java (2.14.0-1) ... Selecting previously unselected package liblz4-jni. -Preparing to unpack .../353-liblz4-jni_1.8.0-4_i386.deb ... +Preparing to unpack .../347-liblz4-jni_1.8.0-4_i386.deb ... Unpacking liblz4-jni (1.8.0-4) ... Selecting previously unselected package liblz4-java. -Preparing to unpack .../354-liblz4-java_1.8.0-4_all.deb ... +Preparing to unpack .../348-liblz4-java_1.8.0-4_all.deb ... Unpacking liblz4-java (1.8.0-4) ... Selecting previously unselected package libmockito-java. -Preparing to unpack .../355-libmockito-java_2.23.0-2_all.deb ... +Preparing to unpack .../349-libmockito-java_2.23.0-2_all.deb ... Unpacking libmockito-java (2.23.0-2) ... Selecting previously unselected package libredberry-pipe-java. -Preparing to unpack .../356-libredberry-pipe-java_1.0.0~alpha0-3_all.deb ... +Preparing to unpack .../350-libredberry-pipe-java_1.0.0~alpha0-3_all.deb ... Unpacking libredberry-pipe-java (1.0.0~alpha0-3) ... Selecting previously unselected package libtrove3-java. -Preparing to unpack .../357-libtrove3-java_3.0.3-5_all.deb ... +Preparing to unpack .../351-libtrove3-java_3.0.3-5_all.deb ... Unpacking libtrove3-java (3.0.3-5) ... Setting up libjcifs-java (1.3.19-2) ... Setting up libbcprov-java (1.77-1) ... @@ -2078,7 +2081,6 @@ Setting up libplexus-utils2-java (3.4.2-1) ... Setting up libnpth0t64:i386 (1.6-3.1) ... Setting up libredberry-pipe-java (1.0.0~alpha0-3) ... -Setting up libkeyutils1:i386 (1.6.3-3) ... Setting up libplexus-classworlds-java (2.7.0-1) ... Setting up libqdox-java (1.12.1-3) ... Setting up libicu72:i386 (72.1-4+b1) ... @@ -2125,7 +2127,6 @@ Setting up xkb-data (2.41-2) ... Setting up libencode-locale-perl (1.05-3) ... Setting up libplexus-component-annotations-java (2.1.1-1) ... -Setting up libcom-err2:i386 (1.47.0-2.4) ... Setting up file (1:5.45-3) ... Setting up libpolyglot-maven-java (0.8~tobrien+git20120905-10) ... Setting up libfelix-gogo-runtime-java (0.16.2-1.1) ... @@ -2133,13 +2134,12 @@ Setting up libjzlib-java (1.1.3-3) ... Setting up libjbig0:i386 (2.1-6.1+b1) ... Setting up libelf1t64:i386 (0.191-1+b1) ... -Setting up libkrb5support0:i386 (1.20.1-5+b1) ... Setting up libsasl2-modules-db:i386 (2.1.28+dfsg1-4+b1) ... Setting up tzdata (2024a-3) ... Current default time zone: 'Etc/UTC' -Local time is now: Tue Jun 3 04:39:02 UTC 2025. -Universal Time is now: Tue Jun 3 04:39:02 UTC 2025. +Local time is now: Tue Apr 30 22:20:55 UTC 2024. +Universal Time is now: Tue Apr 30 22:20:55 UTC 2024. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up libgeronimo-annotation-1.3-spec-java (1.3-1) ... @@ -2192,7 +2192,6 @@ Setting up libipc-run-perl (20231003.0-2) ... Setting up libpcsclite1:i386 (2.0.1-1+b1) ... Setting up libsensors5:i386 (1:3.6.0-9) ... -Setting up libk5crypto3:i386 (1.20.1-5+b1) ... Setting up libhamcrest-java (2.2-2) ... Setting up libglapi-mesa:i386 (23.3.5-1) ... Setting up libbsh-java (2.0b4-20) ... @@ -2227,7 +2226,6 @@ Setting up libsub-quote-perl (2.006008-1) ... Setting up libnative-platform-jni (0.14-6) ... Setting up libclass-xsaccessor-perl (1.19-4+b2) ... -Setting up libkrb5-3:i386 (1.20.1-5+b1) ... Setting up liblz4-jni (1.8.0-4) ... Setting up libwayland-egl1:i386 (1.22.0-2.1+b1) ... Setting up libhttpcore-java (4.4.16-1) ... @@ -2310,7 +2308,6 @@ Setting up libxcb-sync1:i386 (1.15-1) ... Setting up testng (6.9.12-4) ... Setting up shared-mime-info (2.4-1) ... -Setting up libgssapi-krb5-2:i386 (1.20.1-5+b1) ... Setting up libcommons-lang3-java (3.14.0-1) ... Setting up libreadline8t64:i386 (8.2-4) ... Setting up libxcb-dri2-0:i386 (1.15-1) ... @@ -2655,7 +2652,11 @@ Building tag database... -> Finished parsing the build-deps I: Building the package -I: Running cd /build/reproducible-path/milib-2.2.0+dfsg/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../milib_2.2.0+dfsg-1_source.changes +I: user script /srv/workspace/pbuilder/51452/tmp/hooks/A99_set_merged_usr starting +Not re-configuring usrmerge for trixie +I: user script /srv/workspace/pbuilder/51452/tmp/hooks/A99_set_merged_usr finished +hostname: Name or service not known +I: Running cd /build/reproducible-path/milib-2.2.0+dfsg/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S > ../milib_2.2.0+dfsg-1_source.changes dpkg-buildpackage: info: source package milib dpkg-buildpackage: info: source version 2.2.0+dfsg-1 dpkg-buildpackage: info: source distribution unstable @@ -2689,7 +2690,7 @@ dh_auto_build mkdir -p .gradle/init.d cp /usr/share/gradle-debian-helper/init.gradle .gradle/init.d/ - gradle --info --console plain --offline --stacktrace --no-daemon --refresh-dependencies --gradle-user-home .gradle -Duser.home=. -Duser.name=debian -Ddebian.package=milib -Dfile.encoding=UTF-8 --parallel --max-workers=22 jar + gradle --info --console plain --offline --stacktrace --no-daemon --refresh-dependencies --gradle-user-home .gradle -Duser.home=. -Duser.name=debian -Ddebian.package=milib -Dfile.encoding=UTF-8 --parallel --max-workers=10 jar openjdk version "17.0.11" 2024-04-16 OpenJDK Runtime Environment (build 17.0.11+9-Debian-1) OpenJDK Server VM (build 17.0.11+9-Debian-1, mixed mode, sharing) @@ -2697,12 +2698,12 @@ To honour the JVM settings for this build a new JVM will be forked. Please consider using the daemon: https://docs.gradle.org/4.4.1/userguide/gradle_daemon.html. Starting process 'Gradle build daemon'. Working directory: /build/reproducible-path/milib-2.2.0+dfsg/.gradle/daemon/4.4.1 Command: /usr/lib/jvm/java-17-openjdk-i386/bin/java --add-opens java.base/java.lang=ALL-UNNAMED -Xbootclasspath/a:/usr/share/java/gradle-helper-hook.jar:/usr/share/java/maven-repo-helper.jar -Dfile.encoding=UTF-8 -Duser.country=US -Duser.language=en -Duser.variant -cp /usr/share/gradle/lib/gradle-launcher-4.4.1.jar org.gradle.launcher.daemon.bootstrap.GradleDaemon 4.4.1 Successfully started process 'Gradle build daemon' -An attempt to start the daemon took 0.855 secs. -The client will now receive all logging from the daemon (pid: 83971). The daemon log file: /build/reproducible-path/milib-2.2.0+dfsg/.gradle/daemon/4.4.1/daemon-83971.out.log +An attempt to start the daemon took 1.229 secs. +The client will now receive all logging from the daemon (pid: 2414). The daemon log file: /build/reproducible-path/milib-2.2.0+dfsg/.gradle/daemon/4.4.1/daemon-2414.out.log Daemon will be stopped at the end of the build stopping after processing Closing daemon's stdin at end of input. The daemon will no longer process any standard input. -Using 22 worker leases. +Using 10 worker leases. Creating new cache for fileHashes, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/4.4.1/fileHashes/fileHashes.bin, access org.gradle.cache.internal.DefaultCacheAccess@b07d97 Creating new cache for resourceHashesCache, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/4.4.1/fileHashes/resourceHashesCache.bin, access org.gradle.cache.internal.DefaultCacheAccess@b07d97 Creating new cache for fileHashes, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/fileHashes/fileHashes.bin, access org.gradle.cache.internal.DefaultCacheAccess@d8aebc @@ -2730,10 +2731,10 @@ Creating new cache for resourceHashesCache, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/fileHashes/resourceHashesCache.bin, access org.gradle.cache.internal.DefaultCacheAccess@d8aebc Creating new cache for taskHistory, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/taskHistory/taskHistory.bin, access org.gradle.cache.internal.DefaultCacheAccess@1e17e1b Creating new cache for outputFiles, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/buildOutputCleanup/outputFiles.bin, access org.gradle.cache.internal.DefaultCacheAccess@12e70dd -:compileJava (Thread[Task worker for ':' Thread 2,5,main]) started. +:compileJava (Thread[Task worker for ':',5,main]) started. :compileJava -Putting task artifact state for task ':compileJava' into context took 0.004 secs. -Creating new cache for metadata-2.36/module-metadata, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/modules-2/metadata-2.36/module-metadata.bin, access org.gradle.cache.internal.DefaultCacheAccess@c346c3 +Putting task artifact state for task ':compileJava' into context took 0.006 secs. +Creating new cache for metadata-2.36/module-metadata, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/modules-2/metadata-2.36/module-metadata.bin, access org.gradle.cache.internal.DefaultCacheAccess@20d7e8 Loading the Maven rules... Replacing org.apache.commons:commons-math3:jar:3.6.1 -> org.apache.commons:commons-math3:jar:debian Replacing cc.redberry:pipe:jar:1.3.0 -> cc.redberry:pipe:jar:1.0.0-alpha0 @@ -2805,7 +2806,7 @@ at java.base/java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:635) at org.gradle.internal.concurrent.ThreadFactoryImpl$ManagedThreadRunnable.run(ThreadFactoryImpl.java:55) at java.base/java.lang.Thread.run(Thread.java:840) -Up-to-date check for task ':compileJava' took 1.992 secs. It is not up-to-date because: +Up-to-date check for task ':compileJava' took 3.826 secs. It is not up-to-date because: No history is available. All input files are considered out-of-date for incremental task ':compileJava'. Compiling with JDK Java compiler API. @@ -2813,37 +2814,37 @@ Note: Recompile with -Xlint:deprecation for details. Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. -:compileJava (Thread[Task worker for ':' Thread 2,5,main]) completed. Took 7.011 secs. -:processResources (Thread[Task worker for ':' Thread 2,5,main]) started. +:compileJava (Thread[Task worker for ':',5,main]) completed. Took 13.772 secs. +:processResources (Thread[Task worker for ':',5,main]) started. :processResources Putting task artifact state for task ':processResources' into context took 0.0 secs. -Up-to-date check for task ':processResources' took 0.009 secs. It is not up-to-date because: +Up-to-date check for task ':processResources' took 0.013 secs. It is not up-to-date because: No history is available. -:processResources (Thread[Task worker for ':' Thread 2,5,main]) completed. Took 0.033 secs. -:classes (Thread[Task worker for ':' Thread 2,5,main]) started. +:processResources (Thread[Task worker for ':',5,main]) completed. Took 0.049 secs. +:classes (Thread[Task worker for ':',5,main]) started. :classes Skipping task ':classes' as it has no actions. -:classes (Thread[Task worker for ':' Thread 2,5,main]) completed. Took 0.0 secs. -:debianMavenPom (Thread[Task worker for ':' Thread 2,5,main]) started. +:classes (Thread[Task worker for ':',5,main]) completed. Took 0.0 secs. +:debianMavenPom (Thread[Task worker for ':',5,main]) started. :debianMavenPom Putting task artifact state for task ':debianMavenPom' into context took 0.0 secs. Up-to-date check for task ':debianMavenPom' took 0.0 secs. It is not up-to-date because: No history is available. Generating pom file /build/reproducible-path/milib-2.2.0+dfsg/build/debian/milib.pom -:debianMavenPom (Thread[Task worker for ':' Thread 2,5,main]) completed. Took 0.077 secs. -:jar (Thread[Task worker for ':' Thread 2,5,main]) started. +:debianMavenPom (Thread[Task worker for ':',5,main]) completed. Took 0.116 secs. +:jar (Thread[Task worker for ':',5,main]) started. :jar Putting task artifact state for task ':jar' into context took 0.0 secs. -Up-to-date check for task ':jar' took 0.015 secs. It is not up-to-date because: +Up-to-date check for task ':jar' took 0.026 secs. It is not up-to-date because: No history is available. -:jar (Thread[Task worker for ':' Thread 2,5,main]) completed. Took 0.181 secs. +:jar (Thread[Task worker for ':',5,main]) completed. Took 0.262 secs. -BUILD SUCCESSFUL in 11s +BUILD SUCCESSFUL in 20s 4 actionable tasks: 4 executed dh_auto_test mkdir -p .gradle/init.d cp /usr/share/gradle-debian-helper/init.gradle .gradle/init.d/ - gradle --info --console plain --offline --stacktrace --no-daemon --refresh-dependencies --gradle-user-home .gradle -Duser.home=. -Duser.name=debian -Ddebian.package=milib -Dfile.encoding=UTF-8 --parallel --max-workers=22 test + gradle --info --console plain --offline --stacktrace --no-daemon --refresh-dependencies --gradle-user-home .gradle -Duser.home=. -Duser.name=debian -Ddebian.package=milib -Dfile.encoding=UTF-8 --parallel --max-workers=10 test openjdk version "17.0.11" 2024-04-16 OpenJDK Runtime Environment (build 17.0.11+9-Debian-1) OpenJDK Server VM (build 17.0.11+9-Debian-1, mixed mode, sharing) @@ -2851,17 +2852,17 @@ To honour the JVM settings for this build a new JVM will be forked. Please consider using the daemon: https://docs.gradle.org/4.4.1/userguide/gradle_daemon.html. Starting process 'Gradle build daemon'. Working directory: /build/reproducible-path/milib-2.2.0+dfsg/.gradle/daemon/4.4.1 Command: /usr/lib/jvm/java-17-openjdk-i386/bin/java --add-opens java.base/java.lang=ALL-UNNAMED -Xbootclasspath/a:/usr/share/java/gradle-helper-hook.jar:/usr/share/java/maven-repo-helper.jar -Dfile.encoding=UTF-8 -Duser.country=US -Duser.language=en -Duser.variant -cp /usr/share/gradle/lib/gradle-launcher-4.4.1.jar org.gradle.launcher.daemon.bootstrap.GradleDaemon 4.4.1 Successfully started process 'Gradle build daemon' -An attempt to start the daemon took 0.878 secs. -The client will now receive all logging from the daemon (pid: 86461). The daemon log file: /build/reproducible-path/milib-2.2.0+dfsg/.gradle/daemon/4.4.1/daemon-86461.out.log +An attempt to start the daemon took 1.241 secs. +The client will now receive all logging from the daemon (pid: 3226). The daemon log file: /build/reproducible-path/milib-2.2.0+dfsg/.gradle/daemon/4.4.1/daemon-3226.out.log Daemon will be stopped at the end of the build stopping after processing Closing daemon's stdin at end of input. The daemon will no longer process any standard input. -Using 22 worker leases. -Creating new cache for fileHashes, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/4.4.1/fileHashes/fileHashes.bin, access org.gradle.cache.internal.DefaultCacheAccess@ac4e8f -Creating new cache for resourceHashesCache, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/4.4.1/fileHashes/resourceHashesCache.bin, access org.gradle.cache.internal.DefaultCacheAccess@ac4e8f -Creating new cache for fileHashes, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/fileHashes/fileHashes.bin, access org.gradle.cache.internal.DefaultCacheAccess@3417b +Using 10 worker leases. +Creating new cache for fileHashes, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/4.4.1/fileHashes/fileHashes.bin, access org.gradle.cache.internal.DefaultCacheAccess@b07d97 +Creating new cache for resourceHashesCache, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/4.4.1/fileHashes/resourceHashesCache.bin, access org.gradle.cache.internal.DefaultCacheAccess@b07d97 +Creating new cache for fileHashes, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/fileHashes/fileHashes.bin, access org.gradle.cache.internal.DefaultCacheAccess@d8aebc Starting Build -Creating new cache for metadata-1.1/results, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/transforms-1/metadata-1.1/results.bin, access org.gradle.cache.internal.DefaultCacheAccess@11d4295 +Creating new cache for metadata-1.1/results, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/transforms-1/metadata-1.1/results.bin, access org.gradle.cache.internal.DefaultCacheAccess@294b77 Settings evaluated using settings file '/build/reproducible-path/milib-2.2.0+dfsg/settings.gradle'. Settings file not found (/build/reproducible-path/milib-2.2.0+dfsg/settings.gradle) Root project name not defined in settings.gradle, defaulting to 'milib' instead of the name of the root directory 'milib-2.2.0+dfsg' @@ -2875,15 +2876,15 @@ Linking the generated javadoc to the system JDK API documentation All projects evaluated. Selected primary task 'test' from project : -Creating new cache for annotation-processors, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/fileContent/annotation-processors.bin, access org.gradle.cache.internal.DefaultCacheAccess@1e4a7bd +Creating new cache for annotation-processors, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/fileContent/annotation-processors.bin, access org.gradle.cache.internal.DefaultCacheAccess@4d08d6 Tasks to be executed: [task ':compileJava', task ':processResources', task ':classes', task ':compileTestJava', task ':processTestResources', task ':testClasses', task ':test'] -Creating new cache for resourceHashesCache, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/fileHashes/resourceHashesCache.bin, access org.gradle.cache.internal.DefaultCacheAccess@3417b -Creating new cache for taskHistory, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/taskHistory/taskHistory.bin, access org.gradle.cache.internal.DefaultCacheAccess@eb2aa3 -Creating new cache for outputFiles, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/buildOutputCleanup/outputFiles.bin, access org.gradle.cache.internal.DefaultCacheAccess@1f9887b -:compileJava (Thread[Task worker for ':' Thread 3,5,main]) started. +Creating new cache for resourceHashesCache, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/fileHashes/resourceHashesCache.bin, access org.gradle.cache.internal.DefaultCacheAccess@d8aebc +Creating new cache for taskHistory, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/4.4.1/taskHistory/taskHistory.bin, access org.gradle.cache.internal.DefaultCacheAccess@1b16e47 +Creating new cache for outputFiles, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/buildOutputCleanup/outputFiles.bin, access org.gradle.cache.internal.DefaultCacheAccess@1a76bb4 +:compileJava (Thread[Task worker for ':',5,main]) started. :compileJava -Putting task artifact state for task ':compileJava' into context took 0.003 secs. -Creating new cache for metadata-2.36/module-metadata, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/modules-2/metadata-2.36/module-metadata.bin, access org.gradle.cache.internal.DefaultCacheAccess@ef228 +Putting task artifact state for task ':compileJava' into context took 0.007 secs. +Creating new cache for metadata-2.36/module-metadata, path /build/reproducible-path/milib-2.2.0+dfsg/.gradle/caches/modules-2/metadata-2.36/module-metadata.bin, access org.gradle.cache.internal.DefaultCacheAccess@b17634 Loading the Maven rules... Replacing org.apache.commons:commons-math3:jar:3.6.1 -> org.apache.commons:commons-math3:jar:debian Replacing cc.redberry:pipe:jar:1.3.0 -> cc.redberry:pipe:jar:1.0.0-alpha0 @@ -2907,21 +2908,21 @@ Passing through org.jsr-305:jsr305:jar:0.x Passing through com.google.errorprone:error_prone_annotations:jar:debian Passing through com.google.errorprone:error_prone_parent:jar:debian -Skipping task ':compileJava' as it is up-to-date (took 0.557 secs). +Skipping task ':compileJava' as it is up-to-date (took 0.896 secs). :compileJava UP-TO-DATE -:compileJava (Thread[Task worker for ':' Thread 3,5,main]) completed. Took 0.587 secs. -:processResources (Thread[Task worker for ':' Thread 3,5,main]) started. +:compileJava (Thread[Task worker for ':',5,main]) completed. Took 0.947 secs. +:processResources (Thread[Task worker for ':',5,main]) started. :processResources Putting task artifact state for task ':processResources' into context took 0.0 secs. -Skipping task ':processResources' as it is up-to-date (took 0.005 secs). +Skipping task ':processResources' as it is up-to-date (took 0.008 secs). :processResources UP-TO-DATE -:processResources (Thread[Task worker for ':' Thread 3,5,main]) completed. Took 0.008 secs. -:classes (Thread[Task worker for ':' Thread 3,5,main]) started. +:processResources (Thread[Task worker for ':',5,main]) completed. Took 0.012 secs. +:classes (Thread[Task worker for ':',5,main]) started. :classes Skipping task ':classes' as it has no actions. :classes UP-TO-DATE -:classes (Thread[Task worker for ':' Thread 3,5,main]) completed. Took 0.0 secs. -:compileTestJava (Thread[Task worker for ':' Thread 3,5,main]) started. +:classes (Thread[Task worker for ':',5,main]) completed. Took 0.0 secs. +:compileTestJava (Thread[Task worker for ':',5,main]) started. :compileTestJava Putting task artifact state for task ':compileTestJava' into context took 0.0 secs. Replacing junit:junit:jar:4.13.2 -> junit:junit:jar:4.x @@ -2937,7 +2938,7 @@ Passing through net.bytebuddy:byte-buddy-dep:jar:debian Passing through org.ow2.asm:asm:jar:debian Passing through org.ow2.asm:asm-commons:jar:debian -Up-to-date check for task ':compileTestJava' took 1.729 secs. It is not up-to-date because: +Up-to-date check for task ':compileTestJava' took 2.725 secs. It is not up-to-date because: No history is available. All input files are considered out-of-date for incremental task ':compileTestJava'. Compiling with JDK Java compiler API. @@ -2945,1327 +2946,617 @@ Note: Recompile with -Xlint:deprecation for details. Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. -:compileTestJava (Thread[Task worker for ':' Thread 3,5,main]) completed. Took 5.608 secs. -:processTestResources (Thread[Task worker for ':' Thread 3,5,main]) started. +:compileTestJava (Thread[Task worker for ':',5,main]) completed. Took 10.108 secs. +:processTestResources (Thread[Task worker for ':',5,main]) started. :processTestResources Putting task artifact state for task ':processTestResources' into context took 0.0 secs. -Up-to-date check for task ':processTestResources' took 0.011 secs. It is not up-to-date because: +Up-to-date check for task ':processTestResources' took 0.021 secs. It is not up-to-date because: No history is available. -:processTestResources (Thread[Task worker for ':' Thread 3,5,main]) completed. Took 0.034 secs. -:testClasses (Thread[Task worker for ':' Thread 3,5,main]) started. +:processTestResources (Thread[Task worker for ':',5,main]) completed. Took 0.06 secs. +:testClasses (Thread[Task worker for ':',5,main]) started. :testClasses Skipping task ':testClasses' as it has no actions. -:testClasses (Thread[Task worker for ':' Thread 3,5,main]) completed. Took 0.0 secs. -:test (Thread[Task worker for ':' Thread 8,5,main]) started. +:testClasses (Thread[Task worker for ':',5,main]) completed. Took 0.0 secs. +:test (Thread[Task worker for ':',5,main]) started. :test Putting task artifact state for task ':test' into context took 0.0 secs. -Up-to-date check for task ':test' took 0.777 secs. It is not up-to-date because: +Up-to-date check for task ':test' took 1.376 secs. It is not up-to-date because: No history is available. -Starting process 'Gradle Test Executor 1'. Working directory: /build/reproducible-path/milib-2.2.0+dfsg Command: /usr/lib/jvm/java-17-openjdk-i386/bin/java -Dorg.gradle.native=false @/tmp/gradle-worker-classpath9183427418593462396txt -Xms1024m -Xmx2048m -Dfile.encoding=UTF-8 -Duser.country=US -Duser.language=en -Duser.variant -ea worker.org.gradle.process.internal.worker.GradleWorkerMain 'Gradle Test Executor 1' +Starting process 'Gradle Test Executor 1'. Working directory: /build/reproducible-path/milib-2.2.0+dfsg Command: /usr/lib/jvm/java-17-openjdk-i386/bin/java -Dorg.gradle.native=false @/tmp/gradle-worker-classpath11363224405637146031txt -Xms1024m -Xmx2048m -Dfile.encoding=UTF-8 -Duser.country=US -Duser.language=en -Duser.variant -ea worker.org.gradle.process.internal.worker.GradleWorkerMain 'Gradle Test Executor 1' Successfully started process 'Gradle Test Executor 1' Gradle Test Executor 1 started executing tests. -com.milaboratory.util.NSequenceWithQualityPrintHelperTest > test1 SKIPPED +com.milaboratory.primitivio.blocks.PrimitivOBlocksTest > benchmark1 SKIPPED -com.milaboratory.util.IntCombinationsTest > test1 STANDARD_OUT - [0, 1] - [0, 2] - [1, 2] +com.milaboratory.primitivio.blocks.PrimitivOBlocksTest > test1 STANDARD_OUT -com.milaboratory.util.RemoveActionTest > test1 STANDARD_OUT - /tmp/milib_9a922c85e40768dda7254ad0a6948c0d6905ce3016257966770566357011 + ================== + High compression: false + Concurrency: 4 + File size: 6799510 + Write time: 395.7ms -com.milaboratory.util.RemoveActionTest > test2 STANDARD_OUT - /tmp/milib_68a10397414c4cb2fc326baccc0a7724a492ff4c15901104753242535993.tmp + O. Stats: + Wall clock time: 400.62ms + Total CPU time: 678.68ms + User wait time: 286.66ms + Serialization time: 379.73ms (55.95%) + Checksum calculation time: 206.4ms (30.41%) + Compression time: 82.88ms (12.21%) + Total IO delay: 49.91ms + Concurrency overhead: 18.89ms + Uncompressed size: 18.44MiB (~2.08KiB per object) + Output size: 6.48MiB (~748B per object; compression = 35.17%) + IO speed: 132.34MiB/s + Concurrency adjusted uncompressed speed: 91.73MiB/s + Actual uncompressed speed: 46.09MiB/s + Actual speed: 16.21MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 62 (~107.1KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 -com.milaboratory.util.VersionInfoTest > test3 SKIPPED + I. Stats 1: + Wall clock time: 271.35ms + Total CPU time: 467.3ms + Serialization time: 246.68ms (52.79%) + Checksum calculation time: 9.7ms (2.08%) + Compression time: 206.08ms (44.1%) + Total IO delay: 28.11ms + Input size: 6.48MiB + Decompressed size: 18.44MiB (compression = 35.17%) + IO speed: 231.59MiB/s + Concurrency adjusted uncompressed speed: 149.89MiB/s + Actual uncompressed speed: 68.03MiB/s + Actual speed: 23.93MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 62 (~107.1KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 -com.milaboratory.util.JsonOverriderTest > test1 STANDARD_OUT - WARNING: unnecessary override -Ob= with the same value. + I. Stats 2: + Wall clock time: 440.42ms + Total CPU time: 643.89ms + Serialization time: 347.38ms (53.95%) + Checksum calculation time: 18.63ms (2.89%) + Compression time: 269.41ms (41.84%) + Total IO delay: 56.33ms + Input size: 12.97MiB + Decompressed size: 36.87MiB (compression = 35.17%) + IO speed: 231.59MiB/s + Concurrency adjusted uncompressed speed: 210.71MiB/s + Actual uncompressed speed: 83.8MiB/s + Actual speed: 29.48MiB/s + Objects: 18158 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 124 (~107.1KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 -com.milaboratory.util.AtomicEnumHistogramTest > test1 STANDARD_OUT - {"labels":["A","B","C","null"],"hist":[1,2,0,1]} + ================== + High compression: false + Concurrency: 4 + File size: 6791878 + Write time: 451.68ms -com.milaboratory.util.CacheTest > test1 STANDARD_OUT - Cache misses:400 - Cache hits:800 + O. Stats: + Wall clock time: 452.6ms + Total CPU time: 484.64ms + User wait time: 285.53ms + Serialization time: 268.33ms (55.37%) + Checksum calculation time: 13.65ms (2.82%) + Compression time: 187.44ms (38.68%) + Total IO delay: 37.65ms + Concurrency overhead: 13.48ms + Uncompressed size: 18.44MiB (~2.08KiB per object) + Output size: 6.48MiB (~748B per object; compression = 35.13%) + IO speed: 175.06MiB/s + Concurrency adjusted uncompressed speed: 128.03MiB/s + Actual uncompressed speed: 40.79MiB/s + Actual speed: 14.33MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 20 (~331.63KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 -com.milaboratory.util.ByteStringTest > testSpeed1 STANDARD_OUT - Time per hash: 140ns - Addition to hash set (per operation): 343ns - Hash set removal (per operation): 292ns - a + I. Stats 1: + Wall clock time: 140.66ms + Total CPU time: 179.99ms + Serialization time: 94.82ms (52.68%) + Checksum calculation time: 8.45ms (4.69%) + Compression time: 76.07ms (42.27%) + Total IO delay: 15.48ms + Input size: 6.48MiB + Decompressed size: 18.44MiB (compression = 35.13%) + IO speed: 431.82MiB/s + Concurrency adjusted uncompressed speed: 384.1MiB/s + Actual uncompressed speed: 131.69MiB/s + Actual speed: 46.27MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 20 (~331.63KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 -com.milaboratory.util.sorting.HashSorterTest > testSingleton STANDARD_OUT - /tmp/milib_265b262be54603f3b3e967394a7b397ad5e8113914920338275640398055 - timeInCollate: 5.88s - timeInCollatorInit: 4.06s - timeAwaitingO: 3.68ms - timeAwaitingI: 1.36s - timeInFinalSorting1: 0ns - timeInFinalSorting2: 15.36ms - timeInFinalSorting3: 49.09ms - /7S (5|27|32): objs=50000 size=3.4MiB + I. Stats 2: + Wall clock time: 440.65ms + Total CPU time: 563.62ms + Serialization time: 365.52ms (64.85%) + Checksum calculation time: 17.26ms (3.06%) + Compression time: 179.39ms (31.83%) + Total IO delay: 33.54ms + Input size: 12.95MiB + Decompressed size: 36.87MiB (compression = 35.13%) + IO speed: 392.56MiB/s + Concurrency adjusted uncompressed speed: 247.48MiB/s + Actual uncompressed speed: 83.8MiB/s + Actual speed: 29.44MiB/s + Objects: 18158 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 40 (~331.63KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 -com.milaboratory.util.sorting.HashSorterTest > test1 STANDARD_OUT - /tmp/milib_e1a733103d4e4e9ea167dc73eaf631c0d863693c4198716190652006083 - timeInCollate: 13.25s - timeInCollatorInit: 833.4ms - timeAwaitingO: 438.88ms - timeAwaitingI: 2.84s - timeInFinalSorting1: 1.88s - timeInFinalSorting2: 892.76ms - timeInFinalSorting3: 641.71ms - /0N (5|27|32): objs=151978 size=8.36MiB - /1N (5|27|32): objs=150557 size=8.56MiB - /2N (5|27|32): objs=159768 size=9.21MiB - /3N (5|27|32): objs=160007 size=9.3MiB - /4N (5|27|32): objs=153936 size=8.8MiB - /5N (5|27|32): objs=154514 size=8.71MiB - /6N (5|27|32): objs=149600 size=8.48MiB - /7N (5|27|32): objs=156681 size=8.86MiB - /8N (5|27|32): objs=158108 size=8.91MiB - /9N (5|27|32): objs=145913 size=7.78MiB - /10N (5|27|32): objs=161104 size=9.33MiB - /11N (5|27|32): objs=157835 size=8.8MiB - /12N (5|27|32): objs=158860 size=9.1MiB - /13N (5|27|32): objs=160232 size=9.02MiB - /14N (5|27|32): objs=150789 size=8.39MiB - /15N (5|27|32): objs=157748 size=9.04MiB - /16N (5|27|32): objs=165421 size=9.46MiB - /17N (5|27|32): objs=162971 size=9.38MiB - /18N (5|27|32): objs=162546 size=9.59MiB - /19N (5|27|32): objs=163775 size=9.17MiB - /20N (5|27|32): objs=153990 size=8.63MiB - /21N (5|27|32): objs=161060 size=9.25MiB - /22N (5|27|32): objs=155730 size=8.99MiB - /23N (5|27|32): objs=150447 size=8.52MiB - /24N (5|27|32): objs=159063 size=9.23MiB - /25N (5|27|32): objs=150616 size=8.3MiB - /26N (5|27|32): objs=156171 size=8.54MiB - /27N (5|27|32): objs=150234 size=8.35MiB - /28N (5|27|32): objs=159167 size=8.95MiB - /29N (5|27|32): objs=150668 size=8.39MiB - /30N (5|27|32): objs=155901 size=8.86MiB - /31N (5|27|32): objs=154610 size=8.73MiB - /0/0N (2|25|36): objs=39410 size=810.2KiB - /0/1N (2|25|36): objs=36416 size=687.69KiB - /0/2N (2|25|36): objs=38273 size=825.51KiB - /0/3N (2|25|36): objs=1466 size=5.91KiB - /0/4S (2|25|36): objs=162 size=152B - /0/5N (2|25|36): objs=3392 size=15.04KiB - /0/6S (2|25|36): objs=151 size=305B - /0/7N (2|25|36): objs=846 size=3.38KiB - /0/8S (2|25|36): objs=149 size=193B - /0/9N (2|25|36): objs=6194 size=28.75KiB - /0/10S (2|25|36): objs=182 size=321B - /0/11N (2|25|36): objs=3518 size=16.03KiB - /0/12S (2|25|36): objs=156 size=124B - /0/13N (2|25|36): objs=3412 size=14.68KiB - /0/14S (2|25|36): objs=159 size=292B - /0/15N (2|25|36): objs=1966 size=8.64KiB - /0/16S (2|25|36): objs=168 size=111B - /0/17N (2|25|36): objs=1808 size=7.54KiB - /0/18S (2|25|36): objs=157 size=107B - /0/19N (2|25|36): objs=913 size=3.56KiB - /0/20S (2|25|36): objs=149 size=211B - /0/21N (2|25|36): objs=963 size=3.73KiB - /0/22S (2|25|36): objs=159 size=329B - /0/23N (2|25|36): objs=617 size=2.39KiB - /0/24S (2|25|36): objs=175 size=191B - /0/25N (2|25|36): objs=1381 size=5.74KiB - /0/26S (2|25|36): objs=161 size=168B - /0/27N (2|25|36): objs=1641 size=6.71KiB - /0/28S (2|25|36): objs=142 size=107B - /0/30S (2|25|36): objs=153 size=320B - /0/31N (2|25|36): objs=4185 size=18.12KiB - /0/32S (2|25|36): objs=160 size=273B - /0/33N (2|25|36): objs=435 size=1.44KiB - /0/34S (2|25|36): objs=167 size=238B - /0/35N (2|25|36): objs=2592 size=11.51KiB - /1/0N (2|25|36): objs=36137 size=722.14KiB - /1/1N (2|25|36): objs=37149 size=782.05KiB - /1/2N (2|25|36): objs=10125 size=53.79KiB - /1/3S (2|25|36): objs=144 size=315B - /1/4N (2|25|36): objs=27289 size=513.9KiB - /1/5N (2|25|36): objs=7056 size=32.76KiB - /1/6S (2|25|36): objs=158 size=170B - /1/7N (2|25|36): objs=4203 size=19.35KiB - /1/8S (2|25|36): objs=144 size=98B - /1/9N (2|25|36): objs=608 size=2.16KiB - /1/10S (2|25|36): objs=167 size=139B - /1/11N (2|25|36): objs=3892 size=18.79KiB - /1/12S (2|25|36): objs=142 size=147B - /1/13N (2|25|36): objs=4188 size=18.99KiB - /1/14S (2|25|36): objs=169 size=239B - /1/15N (2|25|36): objs=466 size=1.65KiB - /1/16S (2|25|36): objs=147 size=95B - /1/17N (2|25|36): objs=718 size=2.72KiB - /1/18S (2|25|36): objs=147 size=323B - /1/19N (2|25|36): objs=1022 size=4.25KiB - /1/20S (2|25|36): objs=148 size=111B - /1/21N (2|25|36): objs=932 size=3.39KiB - /1/22S (2|25|36): objs=147 size=259B - /1/23N (2|25|36): objs=2808 size=13.8KiB - /1/24S (2|25|36): objs=163 size=194B - /1/25N (2|25|36): objs=3795 size=17.91KiB - /1/26S (2|25|36): objs=153 size=200B - /1/28S (2|25|36): objs=147 size=127B - /1/29N (2|25|36): objs=4382 size=20.86KiB - /1/30S (2|25|36): objs=152 size=220B - /1/31N (2|25|36): objs=286 size=795B - /1/32S (2|25|36): objs=167 size=279B - /1/33N (2|25|36): objs=1501 size=6.31KiB - /1/34S (2|25|36): objs=161 size=91B - /1/35N (2|25|36): objs=1544 size=6.18KiB - /2/0N (2|25|36): objs=39633 size=942.43KiB - /2/1N (2|25|36): objs=43359 size=1.06MiB - /2/2N (2|25|36): objs=36985 size=823.82KiB - /2/3N (2|25|36): objs=8709 size=42.52KiB - /2/4S (2|25|36): objs=147 size=258B - /2/5N (2|25|36): objs=2997 size=13.12KiB - /2/6S (2|25|36): objs=144 size=217B - /2/7N (2|25|36): objs=2294 size=9.38KiB - /2/8S (2|25|36): objs=146 size=254B - /2/9N (2|25|36): objs=1199 size=4.74KiB - /2/10S (2|25|36): objs=151 size=124B - /2/11N (2|25|36): objs=1333 size=5.32KiB - /2/12S (2|25|36): objs=125 size=101B - /2/13N (2|25|36): objs=806 size=3.21KiB - /2/14S (2|25|36): objs=150 size=287B - /2/15N (2|25|36): objs=789 size=2.94KiB - /2/16S (2|25|36): objs=175 size=166B - /2/18S (2|25|36): objs=126 size=120B - /2/19N (2|25|36): objs=1617 size=6.71KiB - /2/20S (2|25|36): objs=160 size=231B - /2/21N (2|25|36): objs=1966 size=8.21KiB - /2/22S (2|25|36): objs=173 size=273B - /2/23N (2|25|36): objs=2159 size=9.19KiB - /2/24S (2|25|36): objs=140 size=321B - /2/25N (2|25|36): objs=4665 size=20.73KiB - /2/26S (2|25|36): objs=135 size=217B - /2/27S (2|25|36): objs=141 size=278B - /2/28S (2|25|36): objs=160 size=122B - /2/29N (2|25|36): objs=3953 size=17.95KiB - /2/30S (2|25|36): objs=136 size=161B - /2/31N (2|25|36): objs=1813 size=7.96KiB - /2/32S (2|25|36): objs=152 size=173B - /2/33N (2|25|36): objs=1309 size=5.4KiB - /2/34S (2|25|36): objs=163 size=115B - /2/35N (2|25|36): objs=1658 size=6.89KiB - /3/0N (2|25|36): objs=38812 size=834.44KiB - /3/1N (2|25|36): objs=40660 size=1.05MiB - /3/2N (2|25|36): objs=24030 size=248.09KiB - /3/3S (2|25|36): objs=154 size=116B - /3/4N (2|25|36): objs=11103 size=63.38KiB - /3/5N (2|25|36): objs=25713 size=421.89KiB - /3/6S (2|25|36): objs=147 size=103B - /3/7N (2|25|36): objs=2100 size=8.85KiB - /3/8S (2|25|36): objs=155 size=295B - /3/10S (2|25|36): objs=173 size=223B - /3/11N (2|25|36): objs=1620 size=6.75KiB - /3/12S (2|25|36): objs=133 size=225B - /3/13N (2|25|36): objs=3672 size=16.59KiB - /3/14S (2|25|36): objs=133 size=103B - /3/15N (2|25|36): objs=1072 size=4.18KiB - /3/16S (2|25|36): objs=170 size=196B - /3/17S (2|25|36): objs=135 size=250B - /3/18S (2|25|36): objs=135 size=113B - /3/19N (2|25|36): objs=314 size=1.02KiB - /3/20S (2|25|36): objs=151 size=269B - /3/21N (2|25|36): objs=2439 size=10.55KiB - /3/22S (2|25|36): objs=147 size=312B - /3/23N (2|25|36): objs=289 size=831B - /3/24S (2|25|36): objs=152 size=293B - /3/25N (2|25|36): objs=2003 size=8.14KiB - /3/26S (2|25|36): objs=150 size=294B - /3/27S (2|25|36): objs=152 size=323B - /3/28S (2|25|36): objs=148 size=270B - /3/29N (2|25|36): objs=336 size=815B - /3/30S (2|25|36): objs=192 size=132B - /3/31N (2|25|36): objs=1437 size=5.82KiB - /3/32S (2|25|36): objs=149 size=136B - /3/33N (2|25|36): objs=1534 size=6.45KiB - /3/34S (2|25|36): objs=156 size=318B - /3/35S (2|25|36): objs=141 size=264B - /4/0N (2|25|36): objs=38255 size=839.3KiB - /4/1N (2|25|36): objs=38871 size=866.06KiB - /4/2N (2|25|36): objs=36774 size=752.13KiB - /4/3N (2|25|36): objs=2547 size=11.31KiB - /4/4S (2|25|36): objs=144 size=214B - /4/5N (2|25|36): objs=766 size=2.98KiB - /4/6S (2|25|36): objs=153 size=224B - /4/8S (2|25|36): objs=155 size=94B - /4/9N (2|25|36): objs=1473 size=5.81KiB - /4/10S (2|25|36): objs=160 size=87B - /4/11N (2|25|36): objs=5528 size=24.97KiB - /4/12S (2|25|36): objs=184 size=255B - /4/13N (2|25|36): objs=313 size=899B - /4/14S (2|25|36): objs=154 size=188B - /4/15N (2|25|36): objs=2327 size=9.81KiB - /4/16S (2|25|36): objs=136 size=323B - /4/17N (2|25|36): objs=1344 size=5.69KiB - /4/18S (2|25|36): objs=141 size=297B - /4/19N (2|25|36): objs=1464 size=6.04KiB - /4/20S (2|25|36): objs=143 size=328B - /4/21N (2|25|36): objs=1188 size=4.91KiB - /4/22S (2|25|36): objs=153 size=259B - /4/23S (2|25|36): objs=152 size=342B - /4/24S (2|25|36): objs=164 size=146B - /4/25N (2|25|36): objs=5228 size=24.36KiB - /4/26S (2|25|36): objs=154 size=256B - /4/27N (2|25|36): objs=939 size=3.65KiB - /4/28S (2|25|36): objs=142 size=283B - /4/29N (2|25|36): objs=3344 size=14.46KiB - /4/30S (2|25|36): objs=172 size=319B - /4/31N (2|25|36): objs=877 size=3.38KiB - /4/32S (2|25|36): objs=146 size=268B - /4/33N (2|25|36): objs=3757 size=18.77KiB - /4/34S (2|25|36): objs=163 size=227B - /4/35N (2|25|36): objs=6325 size=28.23KiB - /5/0N (2|25|36): objs=40420 size=988.22KiB - /5/1N (2|25|36): objs=35947 size=764.81KiB - /5/2N (2|25|36): objs=44145 size=1.05MiB - /5/3N (2|25|36): objs=1726 size=7.05KiB - /5/4S (2|25|36): objs=147 size=258B - /5/5N (2|25|36): objs=3942 size=19.81KiB - /5/6S (2|25|36): objs=153 size=197B - /5/7N (2|25|36): objs=460 size=1.67KiB - /5/8S (2|25|36): objs=145 size=176B - /5/10S (2|25|36): objs=157 size=350B - /5/11N (2|25|36): objs=898 size=3.3KiB - /5/12S (2|25|36): objs=150 size=89B - /5/13N (2|25|36): objs=1084 size=4.14KiB - /5/14S (2|25|36): objs=161 size=124B - /5/15N (2|25|36): objs=446 size=1.31KiB - /5/16S (2|25|36): objs=159 size=252B - /5/18S (2|25|36): objs=139 size=320B - /5/19N (2|25|36): objs=1589 size=6.37KiB - /5/20S (2|25|36): objs=154 size=247B - /5/21N (2|25|36): objs=492 size=1.59KiB - /5/22S (2|25|36): objs=158 size=191B - /5/23N (2|25|36): objs=484 size=1.72KiB - /5/24S (2|25|36): objs=166 size=120B - /5/25N (2|25|36): objs=2991 size=12.71KiB - /5/26S (2|25|36): objs=151 size=282B - /5/27N (2|25|36): objs=2121 size=8.66KiB - /5/28S (2|25|36): objs=156 size=258B - /5/29N (2|25|36): objs=9774 size=53.55KiB - /5/30S (2|25|36): objs=172 size=331B - /5/31N (2|25|36): objs=2462 size=10.61KiB - /5/32S (2|25|36): objs=166 size=156B - /5/33N (2|25|36): objs=3012 size=13.22KiB - /5/34S (2|25|36): objs=187 size=234B - /6/0N (2|25|36): objs=34538 size=681.31KiB - /6/1N (2|25|36): objs=35879 size=767.68KiB - /6/2N (2|25|36): objs=40343 size=886.84KiB - /6/3N (2|25|36): objs=9408 size=46.63KiB - /6/4S (2|25|36): objs=148 size=224B - /6/5N (2|25|36): objs=968 size=3.87KiB - /6/6S (2|25|36): objs=154 size=205B - /6/7N (2|25|36): objs=1954 size=8.13KiB - /6/8S (2|25|36): objs=175 size=197B - /6/9N (2|25|36): objs=1773 size=7.34KiB - /6/10S (2|25|36): objs=175 size=263B - /6/11N (2|25|36): objs=315 size=736B - /6/12S (2|25|36): objs=147 size=94B - /6/13N (2|25|36): objs=296 size=880B - /6/14S (2|25|36): objs=159 size=203B - /6/15N (2|25|36): objs=2175 size=9.22KiB - /6/16S (2|25|36): objs=154 size=329B - /6/17N (2|25|36): objs=448 size=1.58KiB - /6/18S (2|25|36): objs=163 size=210B - /6/19N (2|25|36): objs=2557 size=11.2KiB - /6/20S (2|25|36): objs=154 size=347B - /6/21N (2|25|36): objs=2443 size=10.18KiB - /6/22S (2|25|36): objs=167 size=327B - /6/23N (2|25|36): objs=7398 size=35.43KiB - /6/24S (2|25|36): objs=149 size=283B - /6/25N (2|25|36): objs=962 size=3.65KiB - /6/26S (2|25|36): objs=137 size=136B - /6/27N (2|25|36): objs=1632 size=6.6KiB - /6/28S (2|25|36): objs=148 size=221B - /6/30S (2|25|36): objs=157 size=298B - /6/31N (2|25|36): objs=497 size=1.71KiB - /6/32S (2|25|36): objs=147 size=248B - /6/34S (2|25|36): objs=182 size=181B - /6/35N (2|25|36): objs=3498 size=16.42KiB - /7/0N (2|25|36): objs=38165 size=870.75KiB - /7/1N (2|25|36): objs=40011 size=888.22KiB - /7/2N (2|25|36): objs=39232 size=897.52KiB - /7/3N (2|25|36): objs=14980 size=161.3KiB - /7/4S (2|25|36): objs=152 size=230B - /7/5N (2|25|36): objs=1775 size=7.68KiB - /7/6S (2|25|36): objs=133 size=93B - /7/7N (2|25|36): objs=2411 size=10.11KiB - /7/8S (2|25|36): objs=155 size=295B - /7/9N (2|25|36): objs=303 size=883B - /7/10S (2|25|36): objs=165 size=87B - /7/11N (2|25|36): objs=1091 size=4.18KiB - /7/12S (2|25|36): objs=164 size=225B - /7/13N (2|25|36): objs=1661 size=6.83KiB - /7/14S (2|25|36): objs=161 size=145B - /7/15N (2|25|36): objs=1097 size=4.07KiB - /7/16S (2|25|36): objs=166 size=138B - /7/17N (2|25|36): objs=3854 size=19.38KiB - /7/18S (2|25|36): objs=168 size=143B - /7/19N (2|25|36): objs=602 size=2.35KiB - /7/20S (2|25|36): objs=183 size=262B - /7/21N (2|25|36): objs=1177 size=4.8KiB - /7/22S (2|25|36): objs=130 size=202B - /7/23N (2|25|36): objs=290 size=1002B - /7/24S (2|25|36): objs=124 size=107B - /7/25S (2|25|36): objs=148 size=253B - /7/26S (2|25|36): objs=153 size=115B - /7/27N (2|25|36): objs=1179 size=4.71KiB - /7/28S (2|25|36): objs=161 size=143B - /7/29N (2|25|36): objs=1677 size=6.82KiB - /7/30S (2|25|36): objs=154 size=316B - /7/32S (2|25|36): objs=156 size=146B - /7/33N (2|25|36): objs=3334 size=15.43KiB - /7/34S (2|25|36): objs=156 size=112B - /7/35N (2|25|36): objs=1213 size=4.73KiB - /8/0N (2|25|36): objs=37895 size=765.04KiB - /8/1N (2|25|36): objs=38156 size=879.55KiB - /8/2N (2|25|36): objs=20189 size=302.02KiB - /8/3S (2|25|36): objs=167 size=154B - /8/4N (2|25|36): objs=21201 size=232.5KiB - /8/5N (2|25|36): objs=13360 size=70.12KiB - /8/6S (2|25|36): objs=162 size=127B - /8/7N (2|25|36): objs=869 size=3.4KiB - /8/8S (2|25|36): objs=151 size=313B - /8/9S (2|25|36): objs=137 size=117B - /8/10S (2|25|36): objs=146 size=220B - /8/11N (2|25|36): objs=2753 size=11.81KiB - /8/12S (2|25|36): objs=161 size=218B - /8/14S (2|25|36): objs=132 size=236B - /8/15N (2|25|36): objs=2947 size=12.11KiB - /8/16S (2|25|36): objs=165 size=304B - /8/18S (2|25|36): objs=149 size=252B - /8/19N (2|25|36): objs=315 size=941B - /8/20S (2|25|36): objs=148 size=176B - /8/21N (2|25|36): objs=3666 size=15.23KiB - /8/22S (2|25|36): objs=164 size=157B - /8/23N (2|25|36): objs=609 size=2.32KiB - /8/24S (2|25|36): objs=138 size=273B - /8/25N (2|25|36): objs=1115 size=4.27KiB - /8/26S (2|25|36): objs=161 size=319B - /8/27N (2|25|36): objs=2045 size=8.32KiB - /8/28S (2|25|36): objs=150 size=141B - /8/29S (2|25|36): objs=177 size=276B - /8/30S (2|25|36): objs=148 size=115B - /8/31S (2|25|36): objs=147 size=319B - /8/32S (2|25|36): objs=155 size=286B - /8/33N (2|25|36): objs=5423 size=27.58KiB - /8/34S (2|25|36): objs=146 size=203B - /8/35N (2|25|36): objs=4661 size=21.75KiB - /9/0N (2|25|36): objs=38247 size=834.68KiB - /9/1N (2|25|36): objs=36680 size=702.53KiB - /9/2N (2|25|36): objs=39373 size=743.5KiB - /9/3N (2|25|36): objs=2976 size=13.29KiB - /9/4S (2|25|36): objs=161 size=346B - /9/5N (2|25|36): objs=3493 size=15.47KiB - /9/6S (2|25|36): objs=172 size=284B - /9/7N (2|25|36): objs=622 size=2.08KiB - /9/8S (2|25|36): objs=161 size=199B - /9/9N (2|25|36): objs=1744 size=7.2KiB - /9/10S (2|25|36): objs=144 size=298B - /9/11N (2|25|36): objs=1339 size=5.39KiB - /9/12S (2|25|36): objs=147 size=123B - /9/13N (2|25|36): objs=2041 size=8.47KiB - /9/14S (2|25|36): objs=153 size=233B - /9/15N (2|25|36): objs=1044 size=4.14KiB - /9/16S (2|25|36): objs=131 size=278B - /9/17N (2|25|36): objs=7771 size=38.7KiB - /9/18S (2|25|36): objs=160 size=123B - /9/20S (2|25|36): objs=153 size=293B - /9/21N (2|25|36): objs=1800 size=7.34KiB - /9/22S (2|25|36): objs=152 size=339B - /9/23N (2|25|36): objs=280 size=893B - /9/24S (2|25|36): objs=168 size=240B - /9/25N (2|25|36): objs=718 size=2.91KiB - /9/26S (2|25|36): objs=165 size=324B - /9/27N (2|25|36): objs=740 size=2.85KiB - /9/28S (2|25|36): objs=145 size=136B - /9/29N (2|25|36): objs=1719 size=7.05KiB - /9/30S (2|25|36): objs=179 size=351B - /9/31N (2|25|36): objs=2841 size=13.3KiB - /9/32S (2|25|36): objs=152 size=313B - /9/34S (2|25|36): objs=142 size=212B - /10/0N (2|25|36): objs=38928 size=927.06KiB - /10/1N (2|25|36): objs=39580 size=948.42KiB - /10/2N (2|25|36): objs=5716 size=25.57KiB - /10/3S (2|25|36): objs=158 size=141B - /10/4N (2|25|36): objs=36667 size=715.3KiB - /10/5N (2|25|36): objs=963 size=3.66KiB - /10/6S (2|25|36): objs=149 size=180B - /10/7N (2|25|36): objs=2931 size=12.5KiB - /10/8S (2|25|36): objs=151 size=193B - /10/9N (2|25|36): objs=1037 size=4.21KiB - /10/10S (2|25|36): objs=127 size=276B - /10/11N (2|25|36): objs=2173 size=9.05KiB - /10/12S (2|25|36): objs=161 size=225B - /10/13N (2|25|36): objs=750 size=2.92KiB - /10/14S (2|25|36): objs=158 size=176B - /10/15N (2|25|36): objs=1268 size=5.29KiB - /10/16S (2|25|36): objs=160 size=165B - /10/17N (2|25|36): objs=2689 size=11.54KiB - /10/18S (2|25|36): objs=156 size=134B - /10/19N (2|25|36): objs=5548 size=27.91KiB - /10/20S (2|25|36): objs=167 size=357B - /10/21N (2|25|36): objs=4168 size=20.78KiB - /10/22S (2|25|36): objs=167 size=323B - /10/23N (2|25|36): objs=9140 size=50.46KiB - /10/24S (2|25|36): objs=163 size=223B - /10/25N (2|25|36): objs=580 size=2.16KiB - /10/26S (2|25|36): objs=160 size=212B - /10/27N (2|25|36): objs=1608 size=6.51KiB - /10/28S (2|25|36): objs=156 size=211B - /10/29N (2|25|36): objs=311 size=1.04KiB - /10/30S (2|25|36): objs=146 size=285B - /10/31N (2|25|36): objs=1852 size=7.75KiB - /10/32S (2|25|36): objs=133 size=216B - /10/33N (2|25|36): objs=1971 size=8.52KiB - /10/34S (2|25|36): objs=148 size=213B - /10/35N (2|25|36): objs=764 size=2.84KiB - /11/0N (2|25|36): objs=37383 size=698.95KiB - /11/1N (2|25|36): objs=40534 size=907.83KiB - /11/2N (2|25|36): objs=43084 size=1023.37KiB - /11/3S (2|25|36): objs=139 size=290B - /11/4N (2|25|36): objs=1539 size=6.18KiB - /11/5N (2|25|36): objs=2084 size=9.04KiB - /11/6S (2|25|36): objs=132 size=153B - /11/7N (2|25|36): objs=2054 size=8.52KiB - /11/8S (2|25|36): objs=142 size=236B - /11/9N (2|25|36): objs=1322 size=5.41KiB - /11/10S (2|25|36): objs=156 size=107B - /11/11N (2|25|36): objs=1146 size=4.65KiB - /11/12S (2|25|36): objs=158 size=335B - /11/14S (2|25|36): objs=175 size=224B - /11/15N (2|25|36): objs=2823 size=12KiB - /11/16S (2|25|36): objs=162 size=276B - /11/17S (2|25|36): objs=136 size=156B - /11/18S (2|25|36): objs=166 size=326B - /11/19N (2|25|36): objs=9015 size=43.21KiB - /11/20S (2|25|36): objs=140 size=124B - /11/21N (2|25|36): objs=919 size=3.44KiB - /11/22S (2|25|36): objs=134 size=175B - /11/23N (2|25|36): objs=2513 size=12.51KiB - /11/24S (2|25|36): objs=186 size=323B - /11/25N (2|25|36): objs=1577 size=6.41KiB - /11/26S (2|25|36): objs=147 size=319B - /11/27N (2|25|36): objs=3574 size=17.47KiB - /11/28S (2|25|36): objs=159 size=275B - /11/29N (2|25|36): objs=786 size=3.04KiB - /11/30S (2|25|36): objs=146 size=272B - /11/31N (2|25|36): objs=615 size=2.4KiB - /11/32S (2|25|36): objs=177 size=110B - /11/33N (2|25|36): objs=3812 size=18.71KiB - /11/34S (2|25|36): objs=134 size=182B - /11/35N (2|25|36): objs=466 size=1.56KiB - /12/0N (2|25|36): objs=40609 size=980KiB - /12/1N (2|25|36): objs=40831 size=950.22KiB - /12/2N (2|25|36): objs=40322 size=979.12KiB - /12/3N (2|25|36): objs=16491 size=137.27KiB - /12/4S (2|25|36): objs=164 size=86B - /12/5N (2|25|36): objs=584 size=2.27KiB - /12/6S (2|25|36): objs=163 size=140B - /12/7S (2|25|36): objs=148 size=277B - /12/8S (2|25|36): objs=159 size=118B - /12/9N (2|25|36): objs=738 size=2.74KiB - /12/10S (2|25|36): objs=145 size=121B - /12/11N (2|25|36): objs=1658 size=6.76KiB - /12/12S (2|25|36): objs=144 size=253B - /12/13S (2|25|36): objs=148 size=189B - /12/14S (2|25|36): objs=142 size=288B - /12/15N (2|25|36): objs=1808 size=7.42KiB - /12/16S (2|25|36): objs=127 size=123B - /12/17S (2|25|36): objs=140 size=101B - /12/18S (2|25|36): objs=160 size=309B - /12/19N (2|25|36): objs=3540 size=14.93KiB - /12/20S (2|25|36): objs=170 size=133B - /12/21N (2|25|36): objs=331 size=974B - /12/22S (2|25|36): objs=147 size=284B - /12/23N (2|25|36): objs=4555 size=19.65KiB - /12/24S (2|25|36): objs=168 size=313B - /12/25N (2|25|36): objs=434 size=1.42KiB - /12/26S (2|25|36): objs=166 size=258B - /12/28S (2|25|36): objs=179 size=226B - /12/29N (2|25|36): objs=322 size=912B - /12/30S (2|25|36): objs=164 size=278B - /12/31N (2|25|36): objs=1830 size=7.81KiB - /12/32S (2|25|36): objs=148 size=277B - /12/33N (2|25|36): objs=429 size=1.52KiB - /12/34S (2|25|36): objs=137 size=205B - /12/35N (2|25|36): objs=1459 size=6.06KiB - /13/0N (2|25|36): objs=38406 size=868.89KiB - /13/1N (2|25|36): objs=44396 size=1.02MiB - /13/2N (2|25|36): objs=20945 size=243.42KiB - /13/3S (2|25|36): objs=167 size=356B - /13/4N (2|25|36): objs=16151 size=119.37KiB - /13/5N (2|25|36): objs=5740 size=25.87KiB - /13/6S (2|25|36): objs=140 size=197B - /13/7N (2|25|36): objs=5212 size=23.8KiB - /13/8S (2|25|36): objs=149 size=248B - /13/9N (2|25|36): objs=3259 size=16.5KiB - /13/10S (2|25|36): objs=163 size=255B - /13/11N (2|25|36): objs=2315 size=9.99KiB - /13/12S (2|25|36): objs=160 size=188B - /13/13N (2|25|36): objs=2595 size=10.7KiB - /13/14S (2|25|36): objs=156 size=341B - /13/15S (2|25|36): objs=144 size=203B - /13/16S (2|25|36): objs=154 size=318B - /13/17N (2|25|36): objs=442 size=1.63KiB - /13/18S (2|25|36): objs=158 size=187B - /13/19N (2|25|36): objs=445 size=1.46KiB - /13/20S (2|25|36): objs=156 size=94B - /13/21N (2|25|36): objs=1331 size=5.45KiB - /13/22S (2|25|36): objs=154 size=149B - /13/23N (2|25|36): objs=6496 size=29.4KiB - /13/24S (2|25|36): objs=150 size=229B - /13/25S (2|25|36): objs=139 size=220B - /13/26S (2|25|36): objs=152 size=269B - /13/27N (2|25|36): objs=2266 size=9.49KiB - /13/28S (2|25|36): objs=151 size=340B - /13/29N (2|25|36): objs=3167 size=13.47KiB - /13/30S (2|25|36): objs=154 size=344B - /13/31N (2|25|36): objs=1087 size=4.45KiB - /13/32S (2|25|36): objs=148 size=274B - /13/33S (2|25|36): objs=159 size=244B - /13/34S (2|25|36): objs=141 size=301B - /13/35N (2|25|36): objs=3084 size=13.32KiB - /14/0N (2|25|36): objs=37571 size=824.41KiB - /14/1N (2|25|36): objs=36137 size=630.39KiB - /14/2N (2|25|36): objs=38081 size=806.27KiB - /14/3N (2|25|36): objs=4474 size=23.57KiB - /14/4S (2|25|36): objs=139 size=139B - /14/5N (2|25|36): objs=4668 size=20.35KiB - /14/6S (2|25|36): objs=174 size=337B - /14/8S (2|25|36): objs=159 size=272B - /14/9N (2|25|36): objs=451 size=1.62KiB - /14/10S (2|25|36): objs=152 size=127B - /14/12S (2|25|36): objs=147 size=286B - /14/13N (2|25|36): objs=2110 size=8.58KiB - /14/14S (2|25|36): objs=160 size=246B - /14/16S (2|25|36): objs=149 size=119B - /14/17N (2|25|36): objs=2608 size=12.97KiB - /14/18S (2|25|36): objs=131 size=139B - /14/19N (2|25|36): objs=1539 size=6.32KiB - /14/20S (2|25|36): objs=158 size=104B - /14/21N (2|25|36): objs=4172 size=19.08KiB - /14/22S (2|25|36): objs=152 size=106B - /14/23S (2|25|36): objs=164 size=134B - /14/24S (2|25|36): objs=148 size=318B - /14/25N (2|25|36): objs=10399 size=56.92KiB - /14/26S (2|25|36): objs=176 size=277B - /14/27N (2|25|36): objs=633 size=2.28KiB - /14/28S (2|25|36): objs=170 size=184B - /14/29N (2|25|36): objs=2568 size=10.89KiB - /14/30S (2|25|36): objs=145 size=212B - /14/32S (2|25|36): objs=143 size=193B - /14/33N (2|25|36): objs=1211 size=4.82KiB - /14/34S (2|25|36): objs=176 size=283B - /14/35N (2|25|36): objs=1524 size=6.47KiB - /15/0N (2|25|36): objs=38766 size=866.27KiB - /15/1N (2|25|36): objs=39040 size=971.79KiB - /15/2N (2|25|36): objs=40147 size=886.17KiB - /15/3N (2|25|36): objs=5919 size=26.83KiB - /15/4S (2|25|36): objs=167 size=287B - /15/5N (2|25|36): objs=315 size=786B - /15/6S (2|25|36): objs=156 size=152B - /15/7N (2|25|36): objs=1961 size=8.29KiB - /15/8S (2|25|36): objs=145 size=246B - /15/9S (2|25|36): objs=150 size=163B - /15/10S (2|25|36): objs=168 size=251B - /15/11N (2|25|36): objs=2339 size=9.67KiB - /15/12S (2|25|36): objs=162 size=280B - /15/13N (2|25|36): objs=2399 size=10.24KiB - /15/14S (2|25|36): objs=148 size=243B - /15/15N (2|25|36): objs=1085 size=4.3KiB - /15/16S (2|25|36): objs=136 size=117B - /15/17N (2|25|36): objs=3777 size=16.74KiB - /15/18S (2|25|36): objs=160 size=123B - /15/19N (2|25|36): objs=790 size=3.04KiB - /15/20S (2|25|36): objs=159 size=334B - /15/21N (2|25|36): objs=757 size=2.96KiB - /15/22S (2|25|36): objs=153 size=290B - /15/23N (2|25|36): objs=584 size=2.13KiB - /15/24S (2|25|36): objs=160 size=236B - /15/25N (2|25|36): objs=280 size=905B - /15/26S (2|25|36): objs=152 size=238B - /15/27N (2|25|36): objs=2688 size=11.47KiB - /15/28S (2|25|36): objs=182 size=243B - /15/30S (2|25|36): objs=185 size=218B - /15/31N (2|25|36): objs=3880 size=18.37KiB - /15/32S (2|25|36): objs=149 size=215B - /15/33N (2|25|36): objs=7155 size=37.91KiB - /15/34S (2|25|36): objs=141 size=110B - /15/35N (2|25|36): objs=3193 size=14.28KiB - /16/0N (2|25|36): objs=41669 size=986.78KiB - /16/1N (2|25|36): objs=42565 size=1.06MiB - /16/2N (2|25|36): objs=19271 size=232.58KiB - /16/3S (2|25|36): objs=174 size=95B - /16/4N (2|25|36): objs=19214 size=178.12KiB - /16/5N (2|25|36): objs=1400 size=5.63KiB - /16/6S (2|25|36): objs=171 size=293B - /16/7S (2|25|36): objs=163 size=290B - /16/8S (2|25|36): objs=154 size=168B - /16/9N (2|25|36): objs=1549 size=6.04KiB - /16/10S (2|25|36): objs=140 size=280B - /16/11N (2|25|36): objs=6686 size=35.63KiB - /16/12S (2|25|36): objs=132 size=291B - /16/13N (2|25|36): objs=4065 size=22.02KiB - /16/14S (2|25|36): objs=167 size=333B - /16/15N (2|25|36): objs=2055 size=8.89KiB - /16/16S (2|25|36): objs=147 size=225B - /16/17N (2|25|36): objs=2170 size=9.28KiB - /16/18S (2|25|36): objs=154 size=224B - /16/19N (2|25|36): objs=1365 size=5.28KiB - /16/20S (2|25|36): objs=149 size=115B - /16/21N (2|25|36): objs=4839 size=22.68KiB - /16/22S (2|25|36): objs=143 size=187B - /16/23N (2|25|36): objs=741 size=2.9KiB - /16/24S (2|25|36): objs=165 size=97B - /16/25N (2|25|36): objs=1758 size=6.99KiB - /16/26S (2|25|36): objs=144 size=124B - /16/27N (2|25|36): objs=1559 size=6.3KiB - /16/28S (2|25|36): objs=169 size=318B - /16/29N (2|25|36): objs=4963 size=22.83KiB - /16/30S (2|25|36): objs=151 size=234B - /16/31N (2|25|36): objs=4348 size=20.04KiB - /16/32S (2|25|36): objs=132 size=204B - /16/33N (2|25|36): objs=581 size=2.22KiB - /16/34S (2|25|36): objs=136 size=199B - /16/35N (2|25|36): objs=2032 size=8.55KiB - /17/0N (2|25|36): objs=40916 size=916.18KiB - /17/1N (2|25|36): objs=42454 size=918.24KiB - /17/2N (2|25|36): objs=36729 size=750.28KiB - /17/3S (2|25|36): objs=159 size=305B - /17/4N (2|25|36): objs=454 size=1.51KiB - /17/5S (2|25|36): objs=141 size=109B - /17/6N (2|25|36): objs=1642 size=6.81KiB - /17/7N (2|25|36): objs=1077 size=4.1KiB - /17/8S (2|25|36): objs=157 size=320B - /17/9N (2|25|36): objs=254 size=787B - /17/10S (2|25|36): objs=149 size=251B - /17/11N (2|25|36): objs=4178 size=20.79KiB - /17/12S (2|25|36): objs=159 size=171B - /17/13N (2|25|36): objs=756 size=2.84KiB - /17/14S (2|25|36): objs=136 size=316B - /17/15N (2|25|36): objs=1609 size=6.82KiB - /17/16S (2|25|36): objs=169 size=282B - /17/17N (2|25|36): objs=2485 size=10.53KiB - /17/18S (2|25|36): objs=138 size=282B - /17/19N (2|25|36): objs=9177 size=49.64KiB - /17/20S (2|25|36): objs=175 size=200B - /17/21N (2|25|36): objs=5506 size=26.6KiB - /17/22S (2|25|36): objs=159 size=162B - /17/23N (2|25|36): objs=2444 size=10.45KiB - /17/24S (2|25|36): objs=150 size=312B - /17/26S (2|25|36): objs=157 size=312B - /17/27N (2|25|36): objs=1690 size=6.75KiB - /17/28S (2|25|36): objs=166 size=320B - /17/29N (2|25|36): objs=1907 size=7.7KiB - /17/30S (2|25|36): objs=166 size=108B - /17/31N (2|25|36): objs=3230 size=14.39KiB - /17/32S (2|25|36): objs=162 size=148B - /17/33N (2|25|36): objs=1985 size=8.47KiB - /17/34S (2|25|36): objs=136 size=319B - /17/35N (2|25|36): objs=1999 size=8.3KiB - /18/0N (2|25|36): objs=38725 size=953.22KiB - /18/1N (2|25|36): objs=41158 size=1.07MiB - /18/2N (2|25|36): objs=40362 size=964.86KiB - /18/3N (2|25|36): objs=10951 size=68.6KiB - /18/4S (2|25|36): objs=153 size=167B - /18/6S (2|25|36): objs=162 size=181B - /18/7N (2|25|36): objs=314 size=1KiB - /18/8S (2|25|36): objs=164 size=295B - /18/9N (2|25|36): objs=2678 size=11.49KiB - /18/10S (2|25|36): objs=169 size=222B - /18/12S (2|25|36): objs=170 size=329B - /18/13N (2|25|36): objs=462 size=1.48KiB - /18/14S (2|25|36): objs=163 size=261B - /18/15N (2|25|36): objs=1343 size=5.34KiB - /18/16S (2|25|36): objs=147 size=90B - /18/17N (2|25|36): objs=1562 size=6.37KiB - /18/18S (2|25|36): objs=133 size=206B - /18/19N (2|25|36): objs=3803 size=16.39KiB - /18/20S (2|25|36): objs=131 size=238B - /18/21N (2|25|36): objs=9685 size=45.64KiB - /18/22S (2|25|36): objs=167 size=176B - /18/23N (2|25|36): objs=1654 size=7.08KiB - /18/24S (2|25|36): objs=149 size=282B - /18/25N (2|25|36): objs=4212 size=20.02KiB - /18/26S (2|25|36): objs=149 size=153B - /18/27N (2|25|36): objs=1287 size=5.4KiB - /18/28S (2|25|36): objs=166 size=187B - /18/29S (2|25|36): objs=144 size=270B - /18/30S (2|25|36): objs=169 size=187B - /18/31S (2|25|36): objs=148 size=106B - /18/32S (2|25|36): objs=167 size=287B - /18/33N (2|25|36): objs=463 size=1.61KiB - /18/34S (2|25|36): objs=154 size=185B - /18/35N (2|25|36): objs=1082 size=4.32KiB - /19/0N (2|25|36): objs=40833 size=942.37KiB - /19/1N (2|25|36): objs=39663 size=768.49KiB - /19/2N (2|25|36): objs=38996 size=829.18KiB - /19/3N (2|25|36): objs=3939 size=17.35KiB - /19/4S (2|25|36): objs=176 size=313B - /19/5N (2|25|36): objs=464 size=1.64KiB - /19/6S (2|25|36): objs=120 size=288B - /19/7N (2|25|36): objs=2259 size=9.58KiB - /19/8S (2|25|36): objs=126 size=281B - /19/9N (2|25|36): objs=8342 size=41.44KiB - /19/10S (2|25|36): objs=161 size=152B - /19/11N (2|25|36): objs=1009 size=3.92KiB - /19/12S (2|25|36): objs=156 size=221B - /19/13N (2|25|36): objs=481 size=1.83KiB - /19/14S (2|25|36): objs=109 size=103B - /19/15N (2|25|36): objs=290 size=864B - /19/16S (2|25|36): objs=126 size=277B - /19/17S (2|25|36): objs=153 size=139B - /19/18S (2|25|36): objs=166 size=166B - /19/19S (2|25|36): objs=145 size=249B - /19/20S (2|25|36): objs=156 size=346B - /19/21N (2|25|36): objs=4167 size=19.11KiB - /19/22S (2|25|36): objs=156 size=145B - /19/23N (2|25|36): objs=1488 size=6.18KiB - /19/24S (2|25|36): objs=159 size=132B - /19/25N (2|25|36): objs=6374 size=32.21KiB - /19/26S (2|25|36): objs=142 size=116B - /19/27N (2|25|36): objs=2148 size=9.38KiB - /19/28S (2|25|36): objs=146 size=261B - /19/29N (2|25|36): objs=746 size=2.84KiB - /19/30S (2|25|36): objs=146 size=174B - /19/31N (2|25|36): objs=1060 size=4.17KiB - /19/32S (2|25|36): objs=146 size=171B - /19/33N (2|25|36): objs=5204 size=24.16KiB - /19/34S (2|25|36): objs=145 size=251B - /19/35N (2|25|36): objs=3678 size=15.44KiB - /20/0N (2|25|36): objs=39989 size=904.77KiB - /20/1N (2|25|36): objs=40308 size=970.65KiB - /20/2N (2|25|36): objs=28347 size=459.68KiB - /20/3S (2|25|36): objs=162 size=284B - /20/4N (2|25|36): objs=1838 size=7.66KiB - /20/5N (2|25|36): objs=9434 size=45.35KiB - /20/6S (2|25|36): objs=147 size=274B - /20/7S (2|25|36): objs=159 size=333B - /20/8S (2|25|36): objs=175 size=279B - /20/10S (2|25|36): objs=150 size=331B - /20/11N (2|25|36): objs=5280 size=23.96KiB - /20/12S (2|25|36): objs=171 size=216B - /20/13N (2|25|36): objs=4554 size=20.12KiB - /20/14S (2|25|36): objs=141 size=230B - /20/15N (2|25|36): objs=304 size=980B - /20/16S (2|25|36): objs=140 size=288B - /20/17N (2|25|36): objs=3038 size=13.29KiB - /20/18S (2|25|36): objs=149 size=118B - /20/19N (2|25|36): objs=1182 size=4.89KiB - /20/20S (2|25|36): objs=152 size=173B - /20/21N (2|25|36): objs=11900 size=68.25KiB - /20/22S (2|25|36): objs=165 size=296B - /20/23N (2|25|36): objs=2247 size=9.28KiB - /20/24S (2|25|36): objs=152 size=85B - /20/25N (2|25|36): objs=782 size=2.83KiB - /20/26S (2|25|36): objs=185 size=152B - /20/28S (2|25|36): objs=143 size=192B - /20/29N (2|25|36): objs=750 size=2.68KiB - /20/30S (2|25|36): objs=157 size=153B - /20/31N (2|25|36): objs=465 size=1.51KiB - /20/32S (2|25|36): objs=181 size=225B - /20/33N (2|25|36): objs=737 size=2.82KiB - /20/34S (2|25|36): objs=145 size=265B - /20/35S (2|25|36): objs=161 size=165B - /21/0N (2|25|36): objs=39972 size=871.62KiB - /21/1N (2|25|36): objs=39436 size=816.84KiB - /21/2N (2|25|36): objs=39578 size=846.22KiB - /21/3S (2|25|36): objs=158 size=290B - /21/4N (2|25|36): objs=633 size=2.33KiB - /21/5N (2|25|36): objs=474 size=1.55KiB - /21/6S (2|25|36): objs=146 size=220B - /21/7N (2|25|36): objs=1064 size=4.26KiB - /21/8S (2|25|36): objs=151 size=161B - /21/9N (2|25|36): objs=4014 size=19.13KiB - /21/10S (2|25|36): objs=150 size=251B - /21/11N (2|25|36): objs=12119 size=67.89KiB - /21/12S (2|25|36): objs=136 size=271B - /21/13S (2|25|36): objs=151 size=107B - /21/14S (2|25|36): objs=150 size=320B - /21/16S (2|25|36): objs=150 size=323B - /21/17N (2|25|36): objs=4691 size=21.33KiB - /21/18S (2|25|36): objs=164 size=315B - /21/19N (2|25|36): objs=2129 size=9.04KiB - /21/20S (2|25|36): objs=174 size=211B - /21/21N (2|25|36): objs=3192 size=14.1KiB - /21/22S (2|25|36): objs=155 size=238B - /21/23S (2|25|36): objs=146 size=223B - /21/24S (2|25|36): objs=141 size=203B - /21/25N (2|25|36): objs=303 size=888B - /21/26S (2|25|36): objs=169 size=303B - /21/27N (2|25|36): objs=730 size=2.68KiB - /21/28S (2|25|36): objs=167 size=334B - /21/29N (2|25|36): objs=2623 size=11.06KiB - /21/30S (2|25|36): objs=147 size=129B - /21/31N (2|25|36): objs=4016 size=17.35KiB - /21/32S (2|25|36): objs=143 size=285B - /21/33N (2|25|36): objs=2534 size=10.6KiB - /21/34S (2|25|36): objs=154 size=311B - /21/35N (2|25|36): objs=800 size=3.07KiB - /22/0N (2|25|36): objs=38268 size=938.62KiB - /22/1N (2|25|36): objs=40364 size=894.05KiB - /22/2N (2|25|36): objs=34894 size=642.77KiB - /22/3S (2|25|36): objs=142 size=180B - /22/4N (2|25|36): objs=310 size=909B - /22/5S (2|25|36): objs=159 size=270B - /22/6N (2|25|36): objs=295 size=1.01KiB - /22/7S (2|25|36): objs=154 size=124B - /22/8N (2|25|36): objs=4485 size=20.43KiB - /22/9N (2|25|36): objs=2575 size=11.2KiB - /22/10S (2|25|36): objs=146 size=345B - /22/11N (2|25|36): objs=1336 size=5.52KiB - /22/12S (2|25|36): objs=162 size=280B - /22/13N (2|25|36): objs=2619 size=11.28KiB - /22/14S (2|25|36): objs=155 size=260B - /22/15N (2|25|36): objs=8052 size=41.72KiB - /22/16S (2|25|36): objs=125 size=310B - /22/17N (2|25|36): objs=969 size=3.96KiB - /22/18S (2|25|36): objs=149 size=258B - /22/19S (2|25|36): objs=150 size=313B - /22/20S (2|25|36): objs=177 size=360B - /22/21N (2|25|36): objs=10213 size=64.91KiB - /22/22S (2|25|36): objs=138 size=232B - /22/23N (2|25|36): objs=640 size=2.29KiB - /22/24S (2|25|36): objs=167 size=128B - /22/25N (2|25|36): objs=1037 size=4.1KiB - /22/26S (2|25|36): objs=170 size=205B - /22/27N (2|25|36): objs=1215 size=4.89KiB - /22/28S (2|25|36): objs=170 size=204B - /22/30S (2|25|36): objs=146 size=269B - /22/31N (2|25|36): objs=1383 size=5.83KiB - /22/32S (2|25|36): objs=163 size=176B - /22/33N (2|25|36): objs=437 size=1.35KiB - /22/34S (2|25|36): objs=145 size=324B - /22/35N (2|25|36): objs=4020 size=19.63KiB - /23/0N (2|25|36): objs=41299 size=1.03MiB - /23/1N (2|25|36): objs=35985 size=710.43KiB - /23/2N (2|25|36): objs=37656 size=804.23KiB - /23/3N (2|25|36): objs=924 size=3.54KiB - /23/4S (2|25|36): objs=166 size=294B - /23/5N (2|25|36): objs=472 size=1.54KiB - /23/6S (2|25|36): objs=174 size=352B - /23/7S (2|25|36): objs=160 size=136B - /23/8S (2|25|36): objs=160 size=301B - /23/9N (2|25|36): objs=2968 size=12.71KiB - /23/10S (2|25|36): objs=136 size=318B - /23/11N (2|25|36): objs=3571 size=15.2KiB - /23/12S (2|25|36): objs=158 size=197B - /23/13N (2|25|36): objs=2440 size=10.41KiB - /23/14S (2|25|36): objs=149 size=115B - /23/16S (2|25|36): objs=140 size=147B - /23/17N (2|25|36): objs=2231 size=9.65KiB - /23/18S (2|25|36): objs=172 size=341B - /23/19N (2|25|36): objs=434 size=1.54KiB - /23/20S (2|25|36): objs=151 size=295B - /23/21N (2|25|36): objs=2263 size=9.69KiB - /23/22S (2|25|36): objs=140 size=177B - /23/23N (2|25|36): objs=6317 size=31.23KiB - /23/24S (2|25|36): objs=148 size=233B - /23/25N (2|25|36): objs=2887 size=12.76KiB - /23/26S (2|25|36): objs=141 size=222B - /23/27N (2|25|36): objs=769 size=3.06KiB - /23/28S (2|25|36): objs=129 size=310B - /23/29S (2|25|36): objs=166 size=178B - /23/30S (2|25|36): objs=155 size=121B - /23/31N (2|25|36): objs=2111 size=9.08KiB - /23/32S (2|25|36): objs=143 size=293B - /23/33N (2|25|36): objs=2168 size=9.06KiB - /23/34S (2|25|36): objs=150 size=141B - /23/35N (2|25|36): objs=3214 size=13.53KiB - /24/0N (2|25|36): objs=42114 size=1.03MiB - /24/1N (2|25|36): objs=40786 size=968.53KiB - /24/2N (2|25|36): objs=8596 size=46.82KiB - /24/3S (2|25|36): objs=177 size=303B - /24/4N (2|25|36): objs=28889 size=528.58KiB - /24/5N (2|25|36): objs=6008 size=29.37KiB - /24/6S (2|25|36): objs=163 size=309B - /24/7N (2|25|36): objs=11987 size=68.73KiB - /24/8S (2|25|36): objs=162 size=304B - /24/9N (2|25|36): objs=902 size=3.46KiB - /24/10S (2|25|36): objs=139 size=206B - /24/11N (2|25|36): objs=594 size=2.1KiB - /24/12S (2|25|36): objs=161 size=135B - /24/13N (2|25|36): objs=3409 size=16.2KiB - /24/14S (2|25|36): objs=172 size=127B - /24/15N (2|25|36): objs=1274 size=5.07KiB - /24/16S (2|25|36): objs=160 size=251B - /24/18S (2|25|36): objs=156 size=168B - /24/19N (2|25|36): objs=299 size=1020B - /24/20S (2|25|36): objs=163 size=205B - /24/21N (2|25|36): objs=5056 size=24.05KiB - /24/22S (2|25|36): objs=165 size=350B - /24/23N (2|25|36): objs=293 size=732B - /24/24S (2|25|36): objs=164 size=153B - /24/26S (2|25|36): objs=159 size=176B - /24/27N (2|25|36): objs=1250 size=5.15KiB - /24/28S (2|25|36): objs=152 size=314B - /24/29N (2|25|36): objs=1225 size=4.76KiB - /24/30S (2|25|36): objs=156 size=206B - /24/31N (2|25|36): objs=1340 size=5.44KiB - /24/32S (2|25|36): objs=155 size=167B - /24/33N (2|25|36): objs=2176 size=8.82KiB - /24/34S (2|25|36): objs=141 size=94B - /24/35N (2|25|36): objs=320 size=985B - /25/0N (2|25|36): objs=39143 size=779.66KiB - /25/1N (2|25|36): objs=35410 size=712.78KiB - /25/2S (2|25|36): objs=166 size=227B - /25/3N (2|25|36): objs=3590 size=17.14KiB - /25/4N (2|25|36): objs=36376 size=744.65KiB - /25/5N (2|25|36): objs=1409 size=5.68KiB - /25/6S (2|25|36): objs=151 size=213B - /25/7N (2|25|36): objs=4789 size=22.33KiB - /25/8S (2|25|36): objs=154 size=225B - /25/9N (2|25|36): objs=1639 size=6.85KiB - /25/10S (2|25|36): objs=149 size=303B - /25/11N (2|25|36): objs=754 size=2.84KiB - /25/12S (2|25|36): objs=135 size=207B - /25/13N (2|25|36): objs=2839 size=13.21KiB - /25/14S (2|25|36): objs=141 size=163B - /25/15N (2|25|36): objs=1142 size=4.45KiB - /25/16S (2|25|36): objs=145 size=163B - /25/17N (2|25|36): objs=757 size=2.75KiB - /25/18S (2|25|36): objs=170 size=340B - /25/19N (2|25|36): objs=288 size=1.04KiB - /25/20S (2|25|36): objs=162 size=100B - /25/21N (2|25|36): objs=315 size=1.01KiB - /25/22S (2|25|36): objs=177 size=110B - /25/23N (2|25|36): objs=1415 size=5.73KiB - /25/24S (2|25|36): objs=145 size=216B - /25/25N (2|25|36): objs=2375 size=11.01KiB - /25/26S (2|25|36): objs=171 size=253B - /25/27N (2|25|36): objs=1672 size=6.96KiB - /25/28S (2|25|36): objs=163 size=291B - /25/29N (2|25|36): objs=2438 size=10.55KiB - /25/30S (2|25|36): objs=136 size=253B - /25/31N (2|25|36): objs=4658 size=22.59KiB - /25/32S (2|25|36): objs=148 size=204B - /25/34S (2|25|36): objs=144 size=233B - /25/35N (2|25|36): objs=7150 size=35.95KiB - /26/0N (2|25|36): objs=41692 size=918.79KiB - /26/1N (2|25|36): objs=38905 size=829.29KiB - /26/2N (2|25|36): objs=15837 size=89.35KiB - /26/3S (2|25|36): objs=154 size=335B - /26/4N (2|25|36): objs=23623 size=257.05KiB - /26/5N (2|25|36): objs=2381 size=9.97KiB - /26/6S (2|25|36): objs=174 size=223B - /26/7N (2|25|36): objs=1602 size=6.56KiB - /26/8S (2|25|36): objs=147 size=183B - /26/9N (2|25|36): objs=2284 size=9.47KiB - /26/10S (2|25|36): objs=114 size=128B - /26/11N (2|25|36): objs=8919 size=41.5KiB - /26/12S (2|25|36): objs=179 size=99B - /26/13N (2|25|36): objs=1562 size=6.23KiB - /26/14S (2|25|36): objs=133 size=175B - /26/15N (2|25|36): objs=1836 size=7.57KiB - /26/16S (2|25|36): objs=154 size=320B - /26/17S (2|25|36): objs=170 size=290B - /26/18S (2|25|36): objs=140 size=87B - /26/19N (2|25|36): objs=1549 size=6.51KiB - /26/20S (2|25|36): objs=152 size=141B - /26/21N (2|25|36): objs=1863 size=7.71KiB - /26/22S (2|25|36): objs=139 size=303B - /26/23N (2|25|36): objs=1195 size=4.9KiB - /26/24S (2|25|36): objs=169 size=345B - /26/25N (2|25|36): objs=1284 size=5.51KiB - /26/26S (2|25|36): objs=159 size=317B - /26/27N (2|25|36): objs=452 size=1.54KiB - /26/28S (2|25|36): objs=142 size=184B - /26/29N (2|25|36): objs=2290 size=9.66KiB - /26/30S (2|25|36): objs=143 size=250B - /26/31N (2|25|36): objs=1525 size=6.16KiB - /26/32S (2|25|36): objs=179 size=131B - /26/33N (2|25|36): objs=4783 size=22.11KiB - /26/34S (2|25|36): objs=141 size=214B - /27/0N (2|25|36): objs=36299 size=755.83KiB - /27/1S (2|25|36): objs=169 size=280B - /27/2N (2|25|36): objs=4624 size=20.15KiB - /27/3N (2|25|36): objs=35980 size=579.14KiB - /27/4N (2|25|36): objs=37093 size=812.82KiB - /27/5N (2|25|36): objs=4985 size=24.5KiB - /27/6S (2|25|36): objs=149 size=299B - /27/7N (2|25|36): objs=621 size=2.35KiB - /27/8S (2|25|36): objs=156 size=196B - /27/9N (2|25|36): objs=449 size=1.59KiB - /27/10S (2|25|36): objs=169 size=307B - /27/11N (2|25|36): objs=590 size=2.11KiB - /27/12S (2|25|36): objs=162 size=279B - /27/13N (2|25|36): objs=314 size=986B - /27/14S (2|25|36): objs=177 size=182B - /27/15N (2|25|36): objs=792 size=3.06KiB - /27/16S (2|25|36): objs=160 size=280B - /27/18S (2|25|36): objs=135 size=188B - /27/19N (2|25|36): objs=5143 size=27.91KiB - /27/20S (2|25|36): objs=158 size=135B - /27/21N (2|25|36): objs=1248 size=5.06KiB - /27/22S (2|25|36): objs=143 size=216B - /27/23N (2|25|36): objs=2354 size=10.07KiB - /27/24S (2|25|36): objs=182 size=205B - /27/25N (2|25|36): objs=649 size=2.17KiB - /27/26S (2|25|36): objs=139 size=151B - /27/27N (2|25|36): objs=5513 size=25.16KiB - /27/28S (2|25|36): objs=158 size=277B - /27/29N (2|25|36): objs=7744 size=39.04KiB - /27/30S (2|25|36): objs=138 size=204B - /27/31S (2|25|36): objs=145 size=166B - /27/32S (2|25|36): objs=131 size=231B - /27/33N (2|25|36): objs=910 size=3.55KiB - /27/34S (2|25|36): objs=163 size=349B - /27/35N (2|25|36): objs=2292 size=9.65KiB - /28/0N (2|25|36): objs=38713 size=753.31KiB - /28/1N (2|25|36): objs=43112 size=921.59KiB - /28/2N (2|25|36): objs=41213 size=957.59KiB - /28/3N (2|25|36): objs=8141 size=46.63KiB - /28/4S (2|25|36): objs=156 size=151B - /28/5N (2|25|36): objs=596 size=2.15KiB - /28/6S (2|25|36): objs=154 size=223B - /28/7N (2|25|36): objs=448 size=1.38KiB - /28/8S (2|25|36): objs=166 size=187B - /28/9N (2|25|36): objs=1235 size=4.88KiB - /28/10S (2|25|36): objs=175 size=188B - /28/11N (2|25|36): objs=8358 size=41.51KiB - /28/12S (2|25|36): objs=147 size=154B - /28/13N (2|25|36): objs=1087 size=4.11KiB - /28/14S (2|25|36): objs=156 size=141B - /28/15N (2|25|36): objs=3649 size=16.13KiB - /28/16S (2|25|36): objs=149 size=107B - /28/17N (2|25|36): objs=855 size=3.15KiB - /28/18S (2|25|36): objs=141 size=147B - /28/19N (2|25|36): objs=3100 size=13.39KiB - /28/20S (2|25|36): objs=146 size=106B - /28/21N (2|25|36): objs=304 size=988B - /28/22S (2|25|36): objs=139 size=171B - /28/23N (2|25|36): objs=446 size=1.62KiB - /28/24S (2|25|36): objs=166 size=111B - /28/25N (2|25|36): objs=888 size=3.4KiB - /28/26S (2|25|36): objs=157 size=125B - /28/27N (2|25|36): objs=592 size=1.95KiB - /28/28S (2|25|36): objs=164 size=218B - /28/29N (2|25|36): objs=307 size=1.03KiB - /28/30S (2|25|36): objs=178 size=266B - /28/31N (2|25|36): objs=2450 size=10.17KiB - /28/32S (2|25|36): objs=130 size=251B - /28/33N (2|25|36): objs=884 size=3.35KiB - /28/34S (2|25|36): objs=160 size=207B - /28/35N (2|25|36): objs=305 size=960B - /29/0N (2|25|36): objs=41136 size=909.18KiB - /29/1N (2|25|36): objs=33787 size=669.9KiB - /29/2N (2|25|36): objs=38613 size=850.24KiB - /29/3N (2|25|36): objs=14113 size=95.51KiB - /29/4S (2|25|36): objs=140 size=292B - /29/5N (2|25|36): objs=322 size=1.04KiB - /29/6S (2|25|36): objs=177 size=132B - /29/7N (2|25|36): objs=1880 size=7.7KiB - /29/8S (2|25|36): objs=175 size=220B - /29/9N (2|25|36): objs=824 size=2.96KiB - /29/10S (2|25|36): objs=137 size=283B - /29/11N (2|25|36): objs=3116 size=13.64KiB - /29/12S (2|25|36): objs=168 size=346B - /29/13N (2|25|36): objs=2676 size=12.11KiB - /29/14S (2|25|36): objs=148 size=259B - /29/15S (2|25|36): objs=135 size=287B - /29/16S (2|25|36): objs=152 size=334B - /29/17S (2|25|36): objs=146 size=234B - /29/18S (2|25|36): objs=156 size=319B - /29/19S (2|25|36): objs=149 size=178B - /29/20S (2|25|36): objs=171 size=118B - /29/21N (2|25|36): objs=314 size=895B - /29/22S (2|25|36): objs=155 size=317B - /29/24S (2|25|36): objs=152 size=313B - /29/25S (2|25|36): objs=153 size=338B - /29/26S (2|25|36): objs=180 size=213B - /29/27N (2|25|36): objs=461 size=1.68KiB - /29/28S (2|25|36): objs=160 size=346B - /29/29N (2|25|36): objs=416 size=1.45KiB - /29/30S (2|25|36): objs=136 size=222B - /29/31N (2|25|36): objs=4302 size=19.23KiB - /29/32S (2|25|36): objs=151 size=110B - /29/33N (2|25|36): objs=456 size=1.78KiB - /29/34S (2|25|36): objs=154 size=176B - /29/35N (2|25|36): objs=5157 size=25.85KiB - /30/0N (2|25|36): objs=38690 size=909.8KiB - /30/1N (2|25|36): objs=41251 size=872.03KiB - /30/2N (2|25|36): objs=36921 size=780.46KiB - /30/3N (2|25|36): objs=16638 size=138.91KiB - /30/4S (2|25|36): objs=180 size=344B - /30/5N (2|25|36): objs=661 size=2.59KiB - /30/6S (2|25|36): objs=155 size=209B - /30/7N (2|25|36): objs=677 size=2.12KiB - /30/8S (2|25|36): objs=159 size=202B - /30/9N (2|25|36): objs=449 size=1.46KiB - /30/10S (2|25|36): objs=164 size=161B - /30/11N (2|25|36): objs=3815 size=17.5KiB - /30/12S (2|25|36): objs=183 size=347B - /30/13N (2|25|36): objs=672 size=2.45KiB - /30/14S (2|25|36): objs=147 size=148B - /30/15N (2|25|36): objs=1419 size=5.79KiB - /30/16S (2|25|36): objs=160 size=322B - /30/17N (2|25|36): objs=2089 size=8.96KiB - /30/18S (2|25|36): objs=144 size=242B - /30/19N (2|25|36): objs=1944 size=8.35KiB - /30/20S (2|25|36): objs=172 size=276B - /30/21N (2|25|36): objs=882 size=3.56KiB - /30/22S (2|25|36): objs=156 size=336B - /30/23N (2|25|36): objs=1659 size=6.93KiB - /30/24S (2|25|36): objs=158 size=86B - /30/25N (2|25|36): objs=932 size=3.72KiB - /30/26S (2|25|36): objs=136 size=280B - /30/27N (2|25|36): objs=1727 size=7.18KiB - /30/28S (2|25|36): objs=153 size=129B - /30/29N (2|25|36): objs=491 size=1.56KiB - /30/30S (2|25|36): objs=153 size=257B - /30/31N (2|25|36): objs=1046 size=3.97KiB - /30/32S (2|25|36): objs=154 size=295B - /30/33N (2|25|36): objs=1140 size=4.68KiB - /30/34S (2|25|36): objs=151 size=86B - /30/35N (2|25|36): objs=273 size=870B - /31/0N (2|25|36): objs=38305 size=791.2KiB - /31/1N (2|25|36): objs=39135 size=908.43KiB - /31/2N (2|25|36): objs=39175 size=837.16KiB - /31/3S (2|25|36): objs=161 size=146B - /31/4S (2|25|36): objs=150 size=197B - /31/5N (2|25|36): objs=1731 size=7.75KiB - /31/6S (2|25|36): objs=155 size=211B - /31/7N (2|25|36): objs=7109 size=33.89KiB - /31/8S (2|25|36): objs=168 size=332B - /31/9N (2|25|36): objs=2188 size=9.29KiB - /31/10S (2|25|36): objs=153 size=117B - /31/11N (2|25|36): objs=3868 size=16.37KiB - /31/12S (2|25|36): objs=168 size=222B - /31/13N (2|25|36): objs=625 size=2.33KiB - /31/14S (2|25|36): objs=131 size=92B - /31/15N (2|25|36): objs=1734 size=7.3KiB - /31/16S (2|25|36): objs=133 size=285B - /31/17N (2|25|36): objs=1500 size=6.28KiB - /31/18S (2|25|36): objs=151 size=256B - /31/19N (2|25|36): objs=628 size=2.17KiB - /31/20S (2|25|36): objs=163 size=197B - /31/21N (2|25|36): objs=726 size=2.89KiB - /31/22S (2|25|36): objs=153 size=165B - /31/23N (2|25|36): objs=5761 size=25.69KiB - /31/24S (2|25|36): objs=152 size=145B - /31/25N (2|25|36): objs=1625 size=6.55KiB - /31/26S (2|25|36): objs=150 size=327B - /31/27N (2|25|36): objs=1520 size=6.5KiB - /31/28S (2|25|36): objs=165 size=252B - /31/29N (2|25|36): objs=588 size=2.08KiB - /31/30S (2|25|36): objs=169 size=281B - /31/31N (2|25|36): objs=4688 size=21.36KiB - /31/32S (2|25|36): objs=178 size=139B - /31/33N (2|25|36): objs=731 size=2.86KiB - /31/34S (2|25|36): objs=150 size=278B - /31/35N (2|25|36): objs=323 size=1.02KiB + ================== + High compression: false + Concurrency: 1 + File size: 6799510 + Write time: 321.86ms -com.milaboratory.util.sorting.HashSorterTest > test2 SKIPPED + O. Stats: + Wall clock time: 323ms + Total CPU time: 242.92ms + User wait time: 242.64ms + Serialization time: 132.08ms (54.37%) + Checksum calculation time: 8.44ms (3.48%) + Compression time: 56.17ms (23.12%) + Total IO delay: 24.73ms + Concurrency overhead: 3.92ms + Uncompressed size: 18.44MiB (~2.08KiB per object) + Output size: 6.48MiB (~748B per object; compression = 35.17%) + IO speed: 270.19MiB/s + Concurrency adjusted uncompressed speed: 68.03MiB/s + Actual uncompressed speed: 57.26MiB/s + Actual speed: 20.14MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 62 (~107.1KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + Checksum ok! -com.milaboratory.util.sorting.SortingUtilTest > test1 STANDARD_OUT - Collation: 80.34ms - Sorting: 72.83ms - 1 - 217 - 41384 - 99519 - 99998 + I. Stats 1: + Wall clock time: 152.49ms + Total CPU time: 197.18ms + Serialization time: 105.14ms (53.32%) + Checksum calculation time: 8.27ms (4.19%) + Compression time: 80.33ms (40.74%) + Total IO delay: 26.21ms + Input size: 6.48MiB + Decompressed size: 18.44MiB (compression = 35.17%) + IO speed: 249.4MiB/s + Concurrency adjusted uncompressed speed: 82.68MiB/s + Actual uncompressed speed: 121.3MiB/s + Actual speed: 42.66MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 62 (~107.1KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 -com.milaboratory.core.io.sequence.fasta.RandomAccessFastaReaderTest > test1nt STANDARD_ERROR - Indexing milib_9b3f6dfe21c2d23f8161026aa7fd287aa6a08cf07504755400329012718.fasta: 0% - Indexing milib_9b3f6dfe21c2d23f8161026aa7fd287aa6a08cf07504755400329012718.fasta: done + I. Stats 2: + Wall clock time: 455.52ms + Total CPU time: 600.14ms + Serialization time: 368.8ms (61.45%) + Checksum calculation time: 16.64ms (2.77%) + Compression time: 206.23ms (34.36%) + Total IO delay: 43.47ms + Input size: 12.97MiB + Decompressed size: 36.87MiB (compression = 35.17%) + IO speed: 301.61MiB/s + Concurrency adjusted uncompressed speed: 57.35MiB/s + Actual uncompressed speed: 81.04MiB/s + Actual speed: 28.5MiB/s + Objects: 18158 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 124 (~107.1KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 -com.milaboratory.core.io.sequence.fasta.RandomAccessFastaReaderTest > test1 STANDARD_ERROR - Indexing milib_9b3f6dfe21c2d23f8161026aa7fd287aa6a08cf07504755400329012718.fasta: 0% - Indexing milib_9b3f6dfe21c2d23f8161026aa7fd287aa6a08cf07504755400329012718.fasta: done + ================== + High compression: false + Concurrency: 1 + File size: 6791878 + Write time: 243.26ms -com.milaboratory.core.io.sequence.fasta.RandomAccessFastaReaderTest > test2 STANDARD_ERROR - Indexing milib_3942d6e095b23957f12d988e4e1bd874c1a832116968084127829107520.tmp: 0% - Indexing milib_3942d6e095b23957f12d988e4e1bd874c1a832116968084127829107520.tmp: done + O. Stats: + Wall clock time: 244.68ms + Total CPU time: 189.38ms + User wait time: 222.65ms + Serialization time: 105.2ms (55.55%) + Checksum calculation time: 8.3ms (4.38%) + Compression time: 61.37ms (32.41%) + Total IO delay: 27.27ms + Concurrency overhead: 6.31ms + Uncompressed size: 18.44MiB (~2.08KiB per object) + Output size: 6.48MiB (~748B per object; compression = 35.13%) + IO speed: 239.9MiB/s + Concurrency adjusted uncompressed speed: 83.05MiB/s + Actual uncompressed speed: 75.56MiB/s + Actual speed: 26.55MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 20 (~331.63KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + Checksum ok! -com.milaboratory.core.io.util.IOUtilTest > test111 STANDARD_OUT - 3 - 3 - -2147483648 - -9223372036854775808 + I. Stats 1: + Wall clock time: 403.24ms + Total CPU time: 657.07ms + Serialization time: 443.71ms (67.53%) + Checksum calculation time: 9.62ms (1.46%) + Compression time: 203.06ms (30.9%) + Total IO delay: 20.94ms + Input size: 6.48MiB + Decompressed size: 18.44MiB (compression = 35.13%) + IO speed: 323.86MiB/s + Concurrency adjusted uncompressed speed: 27.19MiB/s + Actual uncompressed speed: 45.75MiB/s + Actual speed: 16.07MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 20 (~331.63KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 -com.milaboratory.core.tree.SequenceTreeMapTest > testCase9 STANDARD_OUT - Hit 1 - 0 ac-gacTtgactg 11 - 0 acTgac-tgactg 11 + I. Stats 2: + Wall clock time: 545.07ms + Total CPU time: 805.97ms + Serialization time: 511.69ms (63.49%) + Checksum calculation time: 18.41ms (2.28%) + Compression time: 274.62ms (34.07%) + Total IO delay: 40.84ms + Input size: 12.95MiB + Decompressed size: 36.87MiB (compression = 35.13%) + IO speed: 323.86MiB/s + Concurrency adjusted uncompressed speed: 43.59MiB/s + Actual uncompressed speed: 67.66MiB/s + Actual speed: 23.77MiB/s + Objects: 18158 + Average object size uncompressed: 2.08KiB + Average object size compressed: 748B + Blocks: 40 (~331.63KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + Pending / IO / Serde: 1 / 0 / 3 - Hit 2 - 0 ac-gactTgactg 11 - 0 acTgact-gactg 11 + ================== + High compression: true + Concurrency: 4 + File size: 4156299 + Write time: 2.25s + O. Stats: + Wall clock time: 2.25s + Total CPU time: 6.15s + User wait time: 2.12s + Serialization time: 115.04ms (1.87%) + Checksum calculation time: 8.52ms (0.14%) + Compression time: 5.95s (96.82%) + Total IO delay: 26.41ms + Concurrency overhead: 7.15ms + Uncompressed size: 18.44MiB (~2.08KiB per object) + Output size: 3.96MiB (~457B per object; compression = 21.5%) + IO speed: 152.45MiB/s + Concurrency adjusted uncompressed speed: 11.89MiB/s + Actual uncompressed speed: 8.19MiB/s + Actual speed: 1.76MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 457B + Blocks: 62 (~65.47KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 -com.milaboratory.core.tree.SequenceTreeMapTest > optimalityAndScopeTest STANDARD_OUT - --NW alignments-- - CASSLAPGATN-KLFF - CASS-APGATNEKLFF + I. Stats 1: + Wall clock time: 83.48ms + Total CPU time: 102.97ms + Serialization time: 36.65ms (35.59%) + Checksum calculation time: 8.32ms (8.08%) + Compression time: 55.22ms (53.63%) + Total IO delay: 15.16ms + Input size: 3.96MiB + Decompressed size: 18.44MiB (compression = 21.5%) + IO speed: 264.25MiB/s + Concurrency adjusted uncompressed speed: 635.76MiB/s + Actual uncompressed speed: 222.13MiB/s + Actual speed: 47.76MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 457B + Blocks: 62 (~65.47KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - CASSLAPGATN-KLFF - CASSLAPG-TNEKLFF + I. Stats 2: + Wall clock time: 161.82ms + Total CPU time: 205.84ms + Serialization time: 74.38ms (36.13%) + Checksum calculation time: 16.83ms (8.18%) + Compression time: 110.02ms (53.45%) + Total IO delay: 29.79ms + Input size: 7.93MiB + Decompressed size: 36.87MiB (compression = 21.5%) + IO speed: 273.36MiB/s + Concurrency adjusted uncompressed speed: 635.76MiB/s + Actual uncompressed speed: 229.03MiB/s + Actual speed: 49.24MiB/s + Objects: 18158 + Average object size uncompressed: 2.08KiB + Average object size compressed: 457B + Blocks: 124 (~65.47KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + Pending / IO / Serde: 2 / 0 / 2 - CASSLAPGATN-KLfF - CASSLAPG-TNEKLyF + ================== + High compression: true + Concurrency: 4 + File size: 4098671 + Write time: 3.55s - --STM alignments-- - CASSLAPGATN-KLFF - CASS-APGATNEKLFF + O. Stats: + Wall clock time: 3.55s + Total CPU time: 5.87s + User wait time: 3.21s + Serialization time: 91.67ms (1.56%) + Checksum calculation time: 8.9ms (0.15%) + Compression time: 5.76s (98.17%) + Total IO delay: 22.88ms + Concurrency overhead: 2.2ms + Uncompressed size: 18.44MiB (~2.08KiB per object) + Output size: 3.91MiB (~451B per object; compression = 21.2%) + IO speed: 177.67MiB/s + Concurrency adjusted uncompressed speed: 12.5MiB/s + Actual uncompressed speed: 5.19MiB/s + Actual speed: 1.1MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 451B + Blocks: 20 (~200.13KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - CASSLAPGATN-KLFF - CASSLAPG-TNEKLFF + I. Stats 1: + Wall clock time: 138.91ms + Total CPU time: 215.34ms + Serialization time: 74.32ms (34.51%) + Checksum calculation time: 9.16ms (4.25%) + Compression time: 131.27ms (60.96%) + Total IO delay: 19.79ms + Input size: 3.91MiB + Decompressed size: 18.44MiB (compression = 21.2%) + IO speed: 205.73MiB/s + Concurrency adjusted uncompressed speed: 317.88MiB/s + Actual uncompressed speed: 133.6MiB/s + Actual speed: 28.32MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 451B + Blocks: 20 (~200.13KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - CASSlAPGATN-KLFF - CASSa-PGATNEKLFF + I. Stats 2: + Wall clock time: 245.36ms + Total CPU time: 332.67ms + Serialization time: 124.46ms (37.41%) + Checksum calculation time: 18.01ms (5.41%) + Compression time: 189.21ms (56.88%) + Total IO delay: 48.24ms + Input size: 7.82MiB + Decompressed size: 36.87MiB (compression = 21.2%) + IO speed: 162.87MiB/s + Concurrency adjusted uncompressed speed: 388.15MiB/s + Actual uncompressed speed: 150.51MiB/s + Actual speed: 31.91MiB/s + Objects: 18158 + Average object size uncompressed: 2.08KiB + Average object size compressed: 451B + Blocks: 40 (~200.13KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + Pending / IO / Serde: 0 / 0 / 1 + Pending / IO / Serde: 0 / 0 / 1 - CASSLAPGaTN-KLFF - CASSLAPGt-NEKLFF + ================== + High compression: true + Concurrency: 1 + File size: 4156299 + Write time: 5.67s - CASSlAPGATN-KLFF - CA-SsAPGATNEKLFF + O. Stats: + Wall clock time: 5.67s + Total CPU time: 5.5s + User wait time: 5.6s + Serialization time: 59.4ms (1.08%) + Checksum calculation time: 8.22ms (0.15%) + Compression time: 5.42s (98.65%) + Total IO delay: 94.99ms + Concurrency overhead: 4.46ms + Uncompressed size: 18.44MiB (~2.08KiB per object) + Output size: 3.96MiB (~457B per object; compression = 21.5%) + IO speed: 42.17MiB/s + Concurrency adjusted uncompressed speed: 3.29MiB/s + Actual uncompressed speed: 3.25MiB/s + Actual speed: 715.85KiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 457B + Blocks: 62 (~65.47KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + Checksum ok! - CASSlAPGATN-KLFF - CAS-sAPGATNEKLFF + I. Stats 1: + Wall clock time: 69.27ms + Total CPU time: 100.09ms + Serialization time: 38.29ms (38.26%) + Checksum calculation time: 8.71ms (8.7%) + Compression time: 52.05ms (52%) + Total IO delay: 10.82ms + Input size: 3.96MiB + Decompressed size: 18.44MiB (compression = 21.5%) + IO speed: 396.38MiB/s + Concurrency adjusted uncompressed speed: 167.61MiB/s + Actual uncompressed speed: 267.2MiB/s + Actual speed: 57.45MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 457B + Blocks: 62 (~65.47KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - CASSLAPGATNk-LFF - CASS-APGATNeKLFF + I. Stats 2: + Wall clock time: 146.78ms + Total CPU time: 199.79ms + Serialization time: 73.66ms (36.87%) + Checksum calculation time: 17.33ms (8.67%) + Compression time: 105.89ms (53%) + Total IO delay: 23.91ms + Input size: 7.93MiB + Decompressed size: 36.87MiB (compression = 21.5%) + IO speed: 344.67MiB/s + Concurrency adjusted uncompressed speed: 165.35MiB/s + Actual uncompressed speed: 252.56MiB/s + Actual speed: 54.3MiB/s + Objects: 18158 + Average object size uncompressed: 2.08KiB + Average object size compressed: 457B + Blocks: 124 (~65.47KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + Pending / IO / Serde: 0 / 0 / 1 + Pending / IO / Serde: 0 / 0 / 1 - CASSLAPGaTN-KLFF - CASSLAP-gTNEKLFF + ================== + High compression: true + Concurrency: 1 + File size: 4098671 + Write time: 5.78s - CASSLAPGATNk-LFF - CASSLAPG-TNeKLFF + O. Stats: + Wall clock time: 5.79s + Total CPU time: 5.69s + User wait time: 5.77s + Serialization time: 61.47ms (1.08%) + Checksum calculation time: 8.34ms (0.15%) + Compression time: 5.62s (98.69%) + Total IO delay: 71.22ms + Concurrency overhead: 5.02ms + Uncompressed size: 18.44MiB (~2.08KiB per object) + Output size: 3.91MiB (~451B per object; compression = 21.2%) + IO speed: 55.05MiB/s + Concurrency adjusted uncompressed speed: 3.2MiB/s + Actual uncompressed speed: 3.19MiB/s + Actual speed: 691.89KiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 451B + Blocks: 20 (~200.13KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + Checksum ok! - CASSLAPGATN-KLfF - CASSLAPG-TNEKLyF + I. Stats 1: + Wall clock time: 79.19ms + Total CPU time: 102.84ms + Serialization time: 35.42ms (34.44%) + Checksum calculation time: 8.71ms (8.47%) + Compression time: 58.38ms (56.77%) + Total IO delay: 10.02ms + Input size: 3.91MiB + Decompressed size: 18.44MiB (compression = 21.2%) + IO speed: 390.88MiB/s + Concurrency adjusted uncompressed speed: 164.62MiB/s + Actual uncompressed speed: 233.38MiB/s + Actual speed: 49.48MiB/s + Objects: 9079 + Average object size uncompressed: 2.08KiB + Average object size compressed: 451B + Blocks: 20 (~200.13KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + Pending / IO / Serde: 0 / 0 / 0 - ------------------ + I. Stats 2: + Wall clock time: 178.29ms + Total CPU time: 202.04ms + Serialization time: 68.12ms (33.72%) + Checksum calculation time: 17.38ms (8.6%) + Compression time: 115.82ms (57.32%) + Total IO delay: 27.9ms + Input size: 7.82MiB + Decompressed size: 36.87MiB (compression = 21.2%) + IO speed: 289.54MiB/s + Concurrency adjusted uncompressed speed: 161.02MiB/s + Actual uncompressed speed: 207.16MiB/s + Actual speed: 43.92MiB/s + Objects: 18158 + Average object size uncompressed: 2.08KiB + Average object size compressed: 451B + Blocks: 40 (~200.13KiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 -com.milaboratory.core.tree.PrimerGenerator > generate SKIPPED +com.milaboratory.primitivio.blocks.PrimitivOBlocksTest > bigBlocks STANDARD_OUT + Pending / IO / Serde / Objs: 0 / 1 / 1 / 1000 + Pending / IO / Serde / Objs: 0 / 1 / 1 / 3000 + Pending / IO / Serde / Objs: 0 / 1 / 0 / 7000 + Pending / IO / Serde / Objs: 0 / 1 / 0 / 10000 + Pending / IO / Serde / Objs: 0 / 1 / 0 / 13000 + Pending / IO / Serde / Objs: 0 / 1 / 0 / 16000 + Pending / IO / Serde / Objs: 0 / 1 / 0 / 19000 + O. Stats: + Wall clock time: 14.89s + Total CPU time: 8.72s + User wait time: 86.72us + Serialization time: 2.73s (31.33%) + Checksum calculation time: 1.08s (12.35%) + Compression time: 2.13s (24.39%) + Total IO delay: 9.09s + Concurrency overhead: 19.47ms + Uncompressed size: 1.86GiB (~97.66KiB per object) + Output size: 1.86GiB (~97.66KiB per object; compression = 100%) + IO speed: 209.86MiB/s + Concurrency adjusted uncompressed speed: 849.26MiB/s + Actual uncompressed speed: 128.07MiB/s + Actual speed: 128.07MiB/s + Objects: 20000 + Average object size uncompressed: 97.66KiB + Average object size compressed: 97.66KiB + Blocks: 20 (~95.37MiB each) + Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 -com.milaboratory.core.sequence.quality.QualityTrimmerTest > testParametersSerialization0 STANDARD_OUT - { - "averageQualityThreshold": 7.0, - "windowSize": 6 - } +com.milaboratory.test.TestUtil > testLT STANDARD_OUT + Short tests. + No system env properties. + +com.milaboratory.core.sequence.ShortSequenceSetTest > test1 STANDARD_OUT + 99952 elements with 366.22KiB in raw nucleotide entropy serialized into 272.98KiB + +com.milaboratory.core.sequence.NucleotideAlphabetTest > testCalculateIntersections SKIPPED com.milaboratory.core.sequence.quality.QualityAggregatorTest > test1 STANDARD_OUT - 31 + 48 com.milaboratory.core.sequence.quality.QualityAggregatorTest > test2 STANDARD_OUT - 643 + 648 com.milaboratory.core.sequence.quality.QualityAggregatorTest > test3 STANDARD_OUT - 2530 + 2460 -com.milaboratory.core.sequence.ShortSequenceSetTest > test1 STANDARD_OUT - 99940 elements with 366.22KiB in raw nucleotide entropy serialized into 273.21KiB +com.milaboratory.core.sequence.quality.QualityTrimmerTest > testParametersSerialization0 STANDARD_OUT + { + "averageQualityThreshold": 7.0, + "windowSize": 6 + } + +com.milaboratory.core.sequence.AminoAcidAlphabetTest > testCalculateMatches SKIPPED + +com.milaboratory.core.sequence.GeneticCodeTest > generateExtendedGeneticCode SKIPPED com.milaboratory.core.sequence.AminoAcidSequenceTest > testName STANDARD_OUT 3 @@ -4367,23 +3658,25 @@ 18 19 -com.milaboratory.core.sequence.GeneticCodeTest > generateExtendedGeneticCode SKIPPED +com.milaboratory.core.motif.BitapPatternTest > ttt STANDARD_OUT + 0 ATTWCCGACA 9 + ||| |||| + 20 ATTT--GACA 27 + [S3:W->T,D4:C,D5:C] + 24 + -26 -com.milaboratory.core.sequence.AminoAcidAlphabetTest > testCalculateMatches SKIPPED +com.milaboratory.core.RangeTest > test23e14 STANDARD_OUT + 1000001 + 1010100 + 1000111 + 1000011 -com.milaboratory.core.sequence.NucleotideAlphabetTest > testCalculateIntersections SKIPPED + 1000010 -com.milaboratory.core.mutations.MutationsTest > testCanonical1 STANDARD_OUT - CCGTCATCACGACGCTGAGTACTGGGTTTCCATTTGGTTTGGTGTTCGCTTCTGCGTTTCCGTTAACTTGTTTTCTTCGGGGAACCCAAACTTGTGTATATTGGCAACTTAACGCCCATAACAGGGGACCTTGTTTTTAGCACTAGAATGTCTGTGGAATTGTAACGTGCGTCAACGTCCCGACCACACGTAATATCTTATTCACCAATTGGTGATTGCAATCCTCGGTTAGCACAACTTCCTTCCAATTATTCCGTTGGGGACGATCCATGGTGCGTGGTGCATCTACACTAAAGGCAAATTTTCCGTACTCGACCGATGGACCCTGAAAATAATCAAGCAGCGATCGCGCCGACAGTACCTTTCTAAAGATGTATGAGCGATGGAGCTTGCGTTAACGCCCAGCAAACTAAAGTACACCCAACAGGGTAAGGAAACAGGAGCACGTGTGTACCGGTTTCAGTAGTAATAATCGCCAACACGTGGCCTTGGAGTTGTATCGAAAATGAAAGACATTTAATCCCCACTAAGACGCTTGGTCCCATCCTTTCAACAAGCCTTTGGGTCACCTCTCAAGGATTCTGAACCAGACTCTCGCGCGGCGACATGATTATCTTTCCGCTCTGCGGTTCAAGACTGCACAGCTGCGGGCATGGGCCTCGGTGCTTTCGCCCTCCAAGCGGGATTGATCTGA - CCGTCATCACGACTCTGAGTACTGGGTTTCCATTGTTTGGTGTTCGGCTTCTCGTTTACCGTTAACTTGTTTTCTTCGGGGAACCCAAACTTGTGTATATTGCAACTTAGCCGCCCATAACAGGAGACCTTGTTTTTAGCACTGGAATGTCTGTGAATGTAACGTGCGCAAACGTCCCGACCAACACGTAGTTTTTATTCACCAATTGGTGATTGCGATCGCTCGGTTAGCACAACTTCCTTCCAATTATTCCGTTGAGGAACGATCCTGTGCGTGGTGCATCTAACTAAAGGCAAATTTTCCGTACCTCGACCGATGGACCCGAAAATATCAAGCAGCGACACGGCTCGTCAGTACCTTTCTAAAGATGATGAGCGATGAGCTGGCGTTAACCGCGCAAACTAAAGTACACCCAACAGGCGTAAGGAACAGGAGCACGTGTGTACGGTTTCAGTGAGTAATAATCGCCACACGTGGCCTTGGAGTTGTATCGAAAAGTGAAAGACATTTAATCCCCCACTAAGAGCTTGTCCCATCCTTAGAAAGCCTTTGGGTGCACCTCTCAAGGATCTGAACCAGACTCCGCGTTGTGACATGATTATCTTTCCGCTCTGCGGTTCAAGACTGCACAGCTGCGGGCATGGGCCTCGGTCGCTTCGCTCTCAAGCGGGATGATCTGA - CCGTCATCACGACTACTGAGTACTGGGTTTCCATTTTTTGTGTTCGGCTTCTCGTTTACCGTTAACATTGTTTTCTTCGGGGACCAAACTTGTGTATATTGCTACTAGCCGCGCCTTACAGGAGACCTTAGGTTTTTGGCACTGGAATGTCTGTGTTGTACGTGCGCAAACGTCCCGACCGACACGTAGTTTTGTATTTACCAATTGGTGATTGCGATCGCTGGTTAGCACAACTTCCTTCCACATTATTCCGTTGAGGAACGATCCTGTGCGTGGTGCATCAGCTGAAGGCTAATTTTCCGATCTCGTCCGATGGACCCGGAAATATCAAGCACGACACGGCTCGGCAGTACCTTTTAAGATGATGAGCGATGGAGCTGGCGTTAGCTGCGCAAACTAAAGTGCACCCAACAGGCGTAAGAAACGAGGAGCACGTGTGTACGGTTTGTGAGTAATATCGCCACACGTGGCCTGGAGTTTTATCGGACAAGTGAAAGACTTTAATCCCCCACTTGGATCTTGCCCCATCTTAGAAAGCCTTTGGCGTGCTCCTCTAGGATCTGAACCAGACTCCCGTTTTGACATGATTATACTTTCCGCTCTGTGGTTCAAGACTCACAGCGCGGGCATTGGCCTCGGTCGCTCCGCTCTCAAGCGGTGTGATCTGA - 0 CCGTCATCACGACTACTGAGTACTGGGTTTCCATTT--TTT-GTGTTCGGCTTCT-CGTTTACCGTTAACATTGTTTTCTTCGGGG-A-CCAAACTTGTGTATATT-GCTAC-TAGCCGCGCC-TTACAGGAGACCTTAGGTTTTTGGCACTGGAATGTCTGT-G--TTGT-ACGTGCG-CAAACGTCCCGACCGACACGTAGT-TTTGTATTTACCAATTGGTGATTGCGATCGCT-GGTTAGCACAACTTCCTTCCACATTATTCCGTTGAGGAACGATCC-T-GTGCGTGGTGCATC-A-GCTGAAGGCTAATTTTCCG-ATCTCGTCCGATGGACCC-GGAAAT-ATCAAGCA-CGA-CACGGCTCGGCAGTACCTTT-T-AAGATG-ATGAGCGATGGAGCTGGCGTT-A-GCTGC-GCAAACTAAAGTGCACCCAACAGGCGTAA-GAAACGAGGAGCACGTGTGTA-CGGTTT--GTGAGTAAT-ATCGCC-ACACGTGGCC-TGGAGTTTTATCGGACAAGTGAAAGAC-TTTAATCCCCCACTTGGA-TCTT-GCCCCAT-C-TT-AGA-AAGCCTTTGGCGTGCTCCTCT--AGGA-TCTGAACCAGACTC-C-CGTTTTGACATGATTATACTTTCCGCTCTGTGGTTCAAGACT-CACAGC-GCGGGCATTGGCCTCGGTCGC-TCCGCTCT-CAAGC-GG-TGTGATCTGA 667 - ||||||||||||| ||||||||||||||||||||| ||| |||||| |||||| ||||| |||||||| ||||||||||||||| | ||||||||||||||||| || || || ||| || | ||||| |||||| |||||| ||||| |||||||||| | |||| ||||||| | |||||||||||| ||||||| | | | |||| |||||||||||||||| ||| || ||||||||||||||||||||| |||||||||||| || ||||||| | |||||||||||||| | || ||||| ||||||||| | |||| ||||||||||| | |||| |||||||| ||| | | || || |||||||||| | |||||| ||||||||||||||| ||||| | || | |||||||||||| ||||||||||| |||| ||||| ||||||||||||||| |||||| || |||||| |||||| |||||||||| ||||||| |||| || || |||||||| |||||| ||||||| || ||| | ||||| | || | | |||||||||| || | ||||| |||| |||||||||||||| | || ||||||||||| |||||||||||| ||||||||||| |||||| |||||||| ||||||||| || | ||| || ||||| || | |||||||| - 0 CCGTCATCACGAC-GCTGAGTACTGGGTTTCCATTTGGTTTGGTGTTC-GCTTCTGCGTTT-CCGTTAAC-TTGTTTTCTTCGGGGAACCCAAACTTGTGTATATTGGCAACTTA-ACGC-CCATAACAGGGGACCTT--GTTTTTAGCACTAGAATGTCTGTGGAATTGTAACGTGCGTC-AACGTCCCGACC-ACACGTAATATCT-TATTCACCAATTGGTGATTGCAATC-CTCGGTTAGCACAACTTCCTTCCA-ATTATTCCGTTG-GGGACGATCCATGGTGCGTGGTGCATCTACACTAAAGGCAAATTTTCCGTA-CTCGACCGATGGACCCTGAAAATAATCAAGCAGCGATCGC-GC-CGACAGTACCTTTCTAAAGATGTATGAGCGATGGAGCTTGCGTTAACGC-CCAGCAAACTAAAGTACACCCAACAGG-GTAAGGAAAC-AGGAGCACGTGTGTACCGGTTTCAGT-AGTAATAATCGCCAACACGTGGCCTTGGAGTTGTATC-GA-AAATGAAAGACATTTAAT-CCCCACTAAGACGCTTGGTCCCATCCTTTCA-ACAAGCCTTTGG-GT-CACCTCTCAAGGATTCTGAACCAGACTCTCGCGCGGCGACATGATTAT-CTTTCCGCTCTGCGGTTCAAGACTGCACAGCTGCGGGCATGGGCCTCGGT-GCTTTCGCCCTCCAAGCGGGAT-TGATCTGA 693 - [D32:T,D35:G,D36:G,I38:G,I38:G,S40:G->T,I41:G,I82:A,S83:A->C,D84:C,I108:T,D109:T,I117:A,S117:A->T,S118:T->A,D119:A,I157:A,S158:A->T,D160:T,I194:A,S194:A->T,S195:T->C,D196:C,D224:T,S225:C->T,I226:C,I308:T,S308:T->A,D309:A,I333:A,D334:A,I353:G,S353:G->A,D354:A,I367:A,D368:A,I384:G,D385:G,I396:A,I397:C,S397:A->G,D399:G,D400:C,I420:C,D421:C,I432:G,S433:G->A,D434:A,I460:C,S460:C->A,S461:A->G,D462:G,I470:A,D471:A,I488:T,D489:T,D501:G,S502:A->G,I506:A,I514:A,S514:A->T,D517:T,I537:G,D538:G,I547:T,S549:T->C,D550:C,D552:A,D553:C,I555:C,I556:A,I573:C,S573:C->A,D575:A,I666:T,D667:T,I675:C,D676:C,I681:G,I683:A,S683:G->T,D684:A,D685:T] - 0 CCGTCATCACGACGCTGAGTACTGGGTTTCCATTTGGT--TTG-GTGTTCGCTTCTGCGTTTCCGTTAACTTGTTTTCTTCGGGG-AACCCAAACTTGTGTATATTGGCAAC-TTAACGCCC-ATAACAGGGGACCTTGTTTTTAGCACTAGAATGTCTGTGG-AATTGTAACGTGCGTCAACGTCCCGACCACACGTAAT-ATCTTATTCACCAATTGGTGATTGCAATCCTC-GGTTAGCACAACTTCCTTCCAATTATTCCGTTGGGGACGATCCATGGTGCGTGGTGCATCTACACTAAAGGCAAATTTTCCG-TACTCGACCGATGGACCCTGAAAAT-AATCAAGCAGCGATCGCGCC-GACAGTACCTTTCT-AAAGATGTATGAGCGAT-GGAGCTTGCGTT-A-ACGCCCAGCAAACTAAAGTACAC-CCAACAGGGTAA-GGAAACAGGAGCACGTGTGTACCGGTTT-CAGTAGTAAT-AATCGCCAACACGTGGCC-TTGGAGTTGTATCGAAAA-TGAAAGAC-ATTTAATCCCCACTAAGACGCTT-GGTCCCATCC-TTTCAACA-A-GCCTTTGGGTCACCTCT-CAAGGATTCTGAACCAGACTCTCGCGCGGCGACATGATTATCTTTCCGCTCTGCGGTTCAAGACTGCACAGCTGCGGGCATGGGCCTCGGTGC-TTTCGCCCT-CCAAGC-GG-GATTGATCTGA 693 - |||||||||||||||||||||||||||||||| || | || ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| | ||||||| ||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |||||||||||||||||| |||||||||||| | ||||||||||||||| | |||||||||| | | ||||||||||||||||||| | |||||||||| | ||||||||||||||||||||||||| ||||||| | |||||||||||||||| | ||||||||||| ||| |||||||| || ||||||||||||||||||| | |||||||| || | | | ||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| | |||| || |||||||| - 0 CCGTCATCACGACGCTGAGTACTGGGTTTCCA-TT--TGGTTTGGTGTTCGCTTCTGCGTTTCCGTTAACTTGTTTTCTTCGGGGAAC-CCAAACTTGTGTATATTGGCAACTT-AACGCCCATA-ACAGGGGACCTTGTTTTTAGCACTAGAATGTCTGTGGAATT-GTAACGTGCGTCAACGTCCCGACCACACGTAATATC-TTATTCACCAATTGGTGATTGCAATCC-TCGGTTAGCACAACTTCCTTCCAATTATTCCGTTGGGGACGATCCATGGTGCGTGGTGCATCTACACTAAAGGCAAATTTTCCGTA-CTCGACCGATGGACCCTGAAAATAA-TCAAGCAGCGATCGCGCCGA-CAGTACCTTTCTAA-AGATGTATGAGCGATGG-AGCTTGCGTTAACGC--CCAGCAAACTAAAGTACACCC-AACAGGGTAAGGA-AACAGGAGCACGTGTGTACCGGTTTCAG-TAGTAATAA-TCGCCAACACGTGGCCTT-GGAGTTGTATC-GAAAATGAAAGACATTT-AATCCCCACTAAGACGCTTGG-TCCCATCCTTTC-A--ACAAGCCTTTGGGTCACCTCTCAA-GGATTCTGAACCAGACTCTCGCGCGGCGACATGATTATCTTTCCGCTCTGCGGTTCAAGACTGCACAGCTGCGGGCATGGGCCTCGGTGCTT-TCGCCCTCC-AAGCGGGAT--TGATCTGA 693 +com.milaboratory.core.mutations.MutationTest > exportRegexps STANDARD_OUT + S([\QAGCTNRYSWKMBDHV\E])(\d+)([\QAGCTNRYSWKMBDHV\E])|D([\QAGCTNRYSWKMBDHV\E])(\d+)|I(\d+)([\QAGCTNRYSWKMBDHV\E]) + S([\Q*ACDEFGHIKLMNPQRSTVWY_XBJZ\E])(\d+)([\Q*ACDEFGHIKLMNPQRSTVWY_XBJZ\E])|D([\Q*ACDEFGHIKLMNPQRSTVWY_XBJZ\E])(\d+)|I(\d+)([\Q*ACDEFGHIKLMNPQRSTVWY_XBJZ\E]) com.milaboratory.core.mutations.MutationsUtilTest > test1111 STANDARD_OUT S([\QAGCTNRYSWKMBDHV\E])(\d+)([\QAGCTNRYSWKMBDHV\E])|D([\QAGCTNRYSWKMBDHV\E])(\d+)|I(\d+)([\QAGCTNRYSWKMBDHV\E]) @@ -4409,77 +3702,209 @@ com.milaboratory.core.mutations.MutationsUtilTest > nt2AAWithMappingManual4 STANDARD_OUT [S3:S->M,D4:D,S5:_->I] -com.milaboratory.core.mutations.MutationTest > exportRegexps STANDARD_OUT - S([\QAGCTNRYSWKMBDHV\E])(\d+)([\QAGCTNRYSWKMBDHV\E])|D([\QAGCTNRYSWKMBDHV\E])(\d+)|I(\d+)([\QAGCTNRYSWKMBDHV\E]) - S([\Q*ACDEFGHIKLMNPQRSTVWY_XBJZ\E])(\d+)([\Q*ACDEFGHIKLMNPQRSTVWY_XBJZ\E])|D([\Q*ACDEFGHIKLMNPQRSTVWY_XBJZ\E])(\d+)|I(\d+)([\Q*ACDEFGHIKLMNPQRSTVWY_XBJZ\E]) +com.milaboratory.core.mutations.MutationsTest > testCanonical1 STANDARD_OUT + CACCTCCCCACGACTTGCACTTAACCGGCGTGGTTCAAACCCGCTCGATTCCCTAACCAGGCAGGTGCCGCATATATCTGCATTGTGTAATCCAACGACCGAACTCTCAATGGGATCGGCCGAGGTGTGCCCTTTCTGTGAGGTCCGACACCAAATCAAGATATTATCAGCAATGTACACCGGCCTCACGTGCGCACATCAGCGGGTTGAAATCAGGTCTGTAAACGATATGTACCAATCGGTGTCCAGACATCGACTTCGCAGCGTGAGGATTAAGGGTAATGGTCGTCGGAGTCGAGGTCTAACCTAACCAGTATAGCAAGTTATGAAGCGAGCTTCACCGGTGACATACTGGAAGGTCTGGATCGGATCGTTAAACGCTGGTGGTTCTTCCATGCTATGTGCACGGTGGCTCCTCCTGTGTTTA + CACTCCCACGACTTGCACTTAACCGGCGTGGTTCAAACCCGCTCGATTCCCTAACAGGCAGGTGCCGCATATATCTGCTTTGTGTAATCCAACGACCGAACTCTCAATGGGATCGGCCGAGGTGTGCCCTTTCTGTGAGGCCGACACCAATCAAGATATTATCAGTAATTACACCGGCCCTCACGTGCTCACATCAGCGTGTTGAAATCAGGTCTGTAAACGATATGTACCAATCAGGTGTCAGACATGATTCGCAGCGTGAGGATTAAGGGTAATGGTCGTCGGGCTCGAGGTCTAACCTAACCAGGATAGCAAGTTCATGAAGCGGGCTTCACCGTGTGACATACTGGCATAGGTCTGGATCGGATTTTATACGACTGGTGTCTTCATGCTATGTGCACGGTGGCTCCCCTCGTGTTTA + CACTGCCCACGACTTGACTTAACCGGCGTGGTTCAAGCCCGCTCGATTCCAACATGGCAGGTGCCCATATCTGCTTTGTTAATCAACGACCGAACTCTCAATGGGATCCGGCCGAGGTGTGTCCTTTCTCGGATGCCGACACCAATCAAGATATTATCAGTATACACCTCCTCAGCGTGCCACTCAGCGTGTGAAATCAGGTTGTAACACGATATGTACCAATCAGGTGTCAGTCATGATTCGCAGCGTGAGGATTAAGGTAATGTCGTCGGGCTCGAGGATCTAACTAACCAGGAAGCAAGTCATGAAGCGGGCTTACCGTGTGACATATTGGCATAGGTCTGGATCGGATTTTATACGACTGGTGTCTCATGCTTGTGCACGGTGGCCTCCCCTCGTGTTA + 0 CA-CTGCCCACGACTTG-ACTTAACCGGCGTGGTTCAAGCCCGCTCGATT-CC-AA-CATGGCAGGTGCC-C--ATATCTGCTTTGT-TAAT-CAACGACCGAACTCTCAATGGGATCCGGCCGAGGTGTGTCCTTTCTCG-GATG-CCGACACC-AATCAAGATATTATCAG---TATACACC-TCCTCAGCGTGC-CAC-TCAGCGTG-TGAAATCAGGT-TGTAACACGATATGTACCAATCAGGTGT-CAGTCAT-GA-TTCGCAGCGTGAGGATTAA-GGTAAT-GTCGTCGG-GCTCGAGGATCTAA-CTAACCAGGA-AGCAAGTCATGAAGCGGGCTT-ACCGTGTGACATATTGGCATAGGTCTGGATCGGAT-TTTATACGACTGGT-G-TC-T-CATGCT-TGTGCACGGTGGCCTCC-CCTCGTG-TTA 402 + || || ||||||||||| |||||||||||||||||||| ||||||||||| || || || |||||||||| | |||||||| |||| |||| |||||||||||||||||||||||| ||||||||||||| ||||||| | || | |||||||| ||||||||||||||||| | |||||| ||||| ||||| ||| |||||| | ||||||||||| ||||| |||||||||||||||| ||||| ||| ||| || ||||||||||||||||||| |||||| |||||||| | |||||| ||||| |||||||| | ||||||| |||||||| |||| |||| |||||||| ||| | ||||||||||||||| ||| ||| ||||| | || | |||||| |||||||||||| |||| ||| ||| ||| + 0 CACCTCCCCACGACTTGCACTTAACCGGCGTGGTTCAAACCCGCTCGATTCCCTAACCA-GGCAGGTGCCGCATATATCTGCATTGTGTAATCCAACGACCGAACTCTCAATGGGAT-CGGCCGAGGTGTGCCCTTTCT-GTGAGGTCCGACACCAAATCAAGATATTATCAGCAATGTACACCGGCCTCA-CGTGCGCACATCAGCGGGTTGAAATCAGGTCTGTAA-ACGATATGTACCAATC-GGTGTCCAGACATCGACTTCGCAGCGTGAGGATTAAGGGTAATGGTCGTCGGAG-TCGAGG-TCTAACCTAACCAGTATAGCAAGTTATGAAGCGAGCTTCACCG-GTGACATACTGG-A-AGGTCTGGATCGGATCGTTAAACG-CTGGTGGTTCTTCCATGCTATGTGCACGGTGG-CTCCTCCT-GTGTTTA 426 + [I5:C,D6:C,I50:C,D51:C,I56:C,D57:C,I71:A,I71:T,D73:A,D74:T,I152:A,D154:A,I170:C,I170:A,I170:A,S170:C->T,S171:A->G,D172:A,D174:G,D175:T,I181:G,D182:G,I245:C,D246:C,I283:G,D284:G,I305:C,D306:C,I385:G,S386:G->T,D387:T,I392:C,D393:C,I423:T,D424:T] + 0 CACCT-CCCCACGACTTGCACTTAACCGGCGTGGTTCAAACCCGCTCGATT-CCCTAA-CCAGGCAGGTGCCGC--ATATATCTGCATTGTGTAATCCAACGACCGAACTCTCAATGGGATCGGCCGAGGTGTGCCCTTTCTGTGAGGTCCGACACC-AAATCAAGATATTATCAG---CAATGTACACC-GGCCTCACGTGCGCACATCAGCGGGTTGAAATCAGGTCTGTAAACGATATGTACCAATCGGTGT-CCAGACATCGACTTCGCAGCGTGAGGATTAAGGGTAAT-GGTCGTCGGAGTCGAGGTCTAA-CCTAACCAGTATAGCAAGTTATGAAGCGAGCTTCACCGGTGACATACTGGAAGGTCTGGATCGGATCGTTAAACGCTGGT-GGTTCTT-CCATGCTATGTGCACGGTGGCTCCTCCTGTG-TTTA 426 + ||||| | ||||||||||||||||||||||||||||||||||||||||||| | |||| | ||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| | ||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| | ||||||||||||||||||||||||||||| | || + 0 CACCTCC-CCACGACTTGCACTTAACCGGCGTGGTTCAAACCCGCTCGATTCC-CTAACC-AGGCAGGTGCCGCATAT--ATCTGCATTGTGTAATCCAACGACCGAACTCTCAATGGGATCGGCCGAGGTGTGCCCTTTCTGTGAGGTCCGACACCAAA-TCAAGATATTATCAGCAATG-T--ACACCGG-CCTCACGTGCGCACATCAGCGGGTTGAAATCAGGTCTGTAAACGATATGTACCAATCGGTGTCC-AGACATCGACTTCGCAGCGTGAGGATTAAGGGTAATGG-TCGTCGGAGTCGAGGTCTAACC-TAACCAGTATAGCAAGTTATGAAGCGAGCTTCACCGGTGACATACTGGAAGGTCTGGATCGGATCGTTAAACGCTGGTGGT-TCTTCC-ATGCTATGTGCACGGTGGCTCCTCCTGTGTT-TA 426 -com.milaboratory.core.merger.MergerParametersTest > test2 STANDARD_OUT - { - "qualityMergingAlgorithm": "SumSubtraction", - "partsLayout": "Collinear", - "minimalOverlap": 15, - "maxQuality": 50, - "minimalIdentity": 0.8, - "identityType": "Unweighted" - } +com.milaboratory.core.alignment.kaligner2.KAligner2Test > testBoundaries STANDARD_OUT + 4965 -com.milaboratory.core.RangeTest > test23e14 STANDARD_OUT - 1000001 - 1010100 - 1000111 - 1000011 +com.milaboratory.core.alignment.kaligner2.KAligner2Test > caseJ1 STANDARD_OUT + 52 + 0 TGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGGA 51 + ||||||||||||||||||||||||||||||||||||||||||||||||||| + 55 TGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGGG 106 + [S51:A->G] + (0->52) + (55->107) - 1000010 +com.milaboratory.core.alignment.kaligner2.KAligner2Test > testCase0 SKIPPED -com.milaboratory.core.motif.BitapPatternTest > ttt STANDARD_OUT - 0 ATTWCCGACA 9 - ||| |||| - 20 ATTT--GACA 27 - [S3:W->T,D4:C,D5:C] - 24 - -26 +com.milaboratory.core.alignment.kaligner2.KAligner2Test > testSimpleRandomTest STANDARD_OUT + Time per query: 871.17us + Processed queries: 49 + Bad percent: 0.0 + False positive percent: 0.5656208572691118 + Scoring error percent: 2.0408163265306123 -com.milaboratory.core.alignment.AlignmentHelperTest > test1 STANDARD_OUT - 0 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGC 29 - |||||||||||||||||||||||||||||| - 0 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGC 29 +com.milaboratory.core.alignment.kaligner2.OffsetPacksAccumulatorTest > testScoreCorrection2 SKIPPED - 30 TTGGT-ACAGCCTGGGGGGTCCCTGAGACT 58 - |||| | |||||||||||||| |||||| - 30 CTGGTCA-AGCCTGGGGGGTCCATGAGACA 58 +com.milaboratory.core.alignment.kaligner2.KMapper2Test > test11112 STANDARD_OUT + ID: 0 + Score: 1719 + Cluster 0: + Q 27 -> T 15 - -12 + Q 30 -> T 18 - -12 + Q 39 -> T 28 - -11 + Q 42 -> T 31 - -11 + Q 45 -> T 34 - -11 + Q 48 -> T 37 - -11 + Q 51 -> T 40 - -11 + Cluster 1: + Q 84 -> T 50 - -34 + Q 87 -> T 53 - -34 + Q 90 -> T 56 - -34 + Q 93 -> T 59 - -34 + Q 96 -> T 62 - -34 + Q 99 -> T 65 - -34 + Q 111 -> T 79 - -32 + Q 114 -> T 82 - -32 + Cluster 2: + Q 150 -> T 92 - -58 + Q 153 -> T 95 - -58 + Q 156 -> T 98 - -58 + Q 159 -> T 101 - -58 + Cluster 3: + Q 201 -> T 123 - -78 + Q 204 -> T 126 - -78 + Q 207 -> T 129 - -78 + Q 216 -> T 139 - -77 + Q 219 -> T 142 - -77 + Q 222 -> T 145 - -77 + Q 231 -> T 153 - -78 + Q 234 -> T 156 - -78 + Q 237 -> T 159 - -78 + Q 240 -> T 162 - -78 + Cluster 4: + Q 246 -> T 178 - -68 + Q 249 -> T 181 - -68 + Q 252 -> T 184 - -68 + Q 255 -> T 187 - -68 + Q 258 -> T 190 - -68 + Q 261 -> T 193 - -68 + Q 262 -> T 194 - -68 - 59 CTCCTGTGCAGCCTCTGGATTCACCTTCAG 88 - |||||||||||||||||||||| ||||||| - 59 CTCCTGTGCAGCCTCTGGATTCCCCTTCAG 88 - 89 TAGC-TATAGCATGAACTGGGTCCGCCAGG 117 - || | ||||||||||||||||||||||||| - 89 TA-CTTATAGCATGAACTGGGTCCGCCAGG 117 +com.milaboratory.core.alignment.kaligner2.KMapper2Test > test1111 STANDARD_OUT + ID: 0 + Score: 1161 + Cluster 0: + Q 9 -> T 15 - 6 + Q 12 -> T 18 - 6 + Q 15 -> T 21 - 6 + Q 18 -> T 24 - 6 + Q 21 -> T 27 - 6 + Q 24 -> T 30 - 6 + Q 27 -> T 33 - 6 + Q 30 -> T 36 - 6 + Cluster 1: + Q 57 -> T 48 - -9 + Q 69 -> T 61 - -8 + Q 78 -> T 69 - -9 + Q 81 -> T 72 - -9 + Q 84 -> T 75 - -9 + Q 87 -> T 78 - -9 + Cluster 2: + Q 123 -> T 89 - -34 + Q 126 -> T 92 - -34 + Q 129 -> T 95 - -34 + Q 132 -> T 98 - -34 + Q 135 -> T 101 - -34 + Q 168 -> T 132 - -36 + Q 171 -> T 135 - -36 + Q 174 -> T 138 - -36 + Q 177 -> T 141 - -36 + Q 180 -> T 144 - -36 + Q 183 -> T 147 - -36 - 118 CTCCAGGGAAGGGGCTGGAGTGGGTTTCAT 147 - ||||||||||||||||||||||||| |||| - 118 CTCCAGGGAAGGGGCTGGAGTGGGTCTCAT 147 - 148 ACATTAGTAGTAGTAGTAG-TACCATATAC 176 - |||||||||| ||||||| || |||||| - 148 CCATTAGTAGTGGTAGTAGTTA-CATATAT 176 +com.milaboratory.core.alignment.kaligner2.KMapper2Test > testRandom1 STANDARD_OUT + noHits: 286 + noHits2: 0 + noHits3: 0 + wrongTopHit: 33 + wrongTopHitS: 23 + noCorrectHitInList: 17 - 177 TACGCAGACTCTGTGAAGGGCCGATTCACC 206 - ||||||||||| |||||||||||||||||| - 177 TACGCAGACTCCGTGAAGGGCCGATTCACC 206 - 207 ATCTCCAGAGACAATGCCAAGAACTCACTG 236 - |||||||||||||| ||||||||||||||| - 207 ATCTCCAGAGACAACGCCAAGAACTCACTG 236 - 237 TATCTGCAAATGAACAGCCTGAGAGACGAG 266 - ||||||||||||||||||||||||| |||| - 237 TATCTGCAAATGAACAGCCTGAGAGCCGAG 266 - 267 GACACGGCTGTGTATTACTGTGC 289 - ||||||||||||||||||||||| - 267 GACACGGCTGTGTATTACTGTGC 289 + Timings: + DescriptiveStatistics: + n: 100000 + min: 10648.0 + max: 2.7339081E8 + mean: 134012.31520001148 + std dev: 2140116.7379706874 + median: 106809.5 + skewness: 101.70137018970148 + kurtosis: 10493.288192115608 + + + + + + Clusters basicSize + DescriptiveStatistics: + n: 99681 + min: 1.0 + max: 6.0 + mean: 2.8746300699230556 + std dev: 1.0993862835596742 + median: 3.0 + skewness: 0.2836739949433447 + kurtosis: -0.6805058811748061 + + + + + + Top Delta + DescriptiveStatistics: + n: 99697 + min: -23.0 + max: 0.0 + mean: -7.623097986898217E-4 + std dev: 0.11277448123893713 + median: 0.0 + skewness: -165.33551375511277 + kurtosis: 29053.06558139477 + + +com.milaboratory.core.alignment.batch.SimpleBatchAlignerTest > test1 STANDARD_OUT + 4 hits. + +com.milaboratory.core.alignment.blast.BlastDBBuilderTest > test1 SKIPPED + +com.milaboratory.core.alignment.blast.BlastAlignerExtTest > test16SMicrobial1 SKIPPED + +com.milaboratory.core.alignment.blast.BlastAlignerExtTest > test1 SKIPPED + +com.milaboratory.core.alignment.blast.BlastAlignerTest > test1 SKIPPED + +com.milaboratory.core.alignment.blast.BlastAlignerTest > simpleRandomTestT1 SKIPPED + +com.milaboratory.core.alignment.blast.BlastAlignerTest > simpleRandomTestT2 SKIPPED + +com.milaboratory.core.alignment.blast.BlastAlignerTest > simpleRandomTestT3 SKIPPED + +com.milaboratory.core.alignment.kaligner1.KMapperTest > testBestOffset2 STANDARD_OUT + -205 + +com.milaboratory.core.alignment.kaligner1.KAlignerTest > testRandomCorrectness STANDARD_OUT + C=1182;I=0;M=0;ScE=0;R=0.0 AlignmentTime = 376.89us + C=1642;I=1;M=0;ScE=0;R=0.0 AlignmentTime = 261.02us + C=2048;I=0;M=0;ScE=0;R=0.0 AlignmentTime = 180.79us + C=2142;I=0;M=0;ScE=0;R=8.333333333333333E-7 AlignmentTime = 179.63us + +com.milaboratory.core.alignment.kaligner1.KAlignerTest > testRandom1 STANDARD_OUT + ##teamcity[buildStatisticValue key='kmFound' value='0.9449'] + ##teamcity[buildStatisticValue key='kmWrong' value='1.0E-4'] + ##teamcity[buildStatisticValue key='kmFalse' value='0.0058'] +com.milaboratory.core.alignment.kaligner1.KAlignerTest > testRandomCorrectnessConcurrent STANDARD_OUT + C=3000;I=0;M=0;ScE=0;R=0.0 AlignmentTime = 177.14us + C=2999;I=0;M=0;ScE=1;R=0.0 AlignmentTime = 167.46us + C=2999;I=0;M=0;ScE=0;R=0.0 AlignmentTime = 163.25us + C=2996;I=0;M=1;ScE=0;R=0.0 AlignmentTime = 246.51us com.milaboratory.core.alignment.BandedAffineAlignerTest > test11 STANDARD_OUT 0 --------------------- -1 @@ -4530,50 +3955,6 @@ 0 gCccTtgtgatgacccagactccagcctccgtgGAGgCaGctgtgggaggcacagtcaccatcaagtgccaggccagtcagagcattagcaacctcttaGCCTGGTATCAGCAGAAACCAGGGCAGCCTCCCAAGCTCCTGATCTATTATGCATCCGATCTGGcatctggggtctcatcaaggttcaaaggcagtggatctgggacagagtAcactctcaccatcagTggcgtgcagtgtgccgatgctgccacttactac 260 1 gAccCtgtgatgacccagactccagcctccgtgTCTgAaCctgtgggaggcacagtcaccatcaagtgccaggccagtcagagcattagcaacctctta-------------------------------------------------------------NNNcatctggggtctcatcaaggttcaaaggcagtggatctgggacagagtTcactctcaccatcagCggcgtgcagtgtgccgatgctgccacttactac 200 -com.milaboratory.core.alignment.BandedLinearAlignerTest > testCase1 STANDARD_OUT - GCGTGAAGACTGCAGGCATTGAGTACGTTACTAGTCCAGTGGGGCCCAACCGTAACATTGCGTGTGACTGGTTGCTTAGCGGGTGACGGCGTTTCAGGTTACGCCCTCTGTGCATCACCGATAGCGTTGTTTGAGCTTTCTAACGTCTCAAACCTGCTTGCGCCCTACGGTTTCTCTATATATACACGAAAGGGGCTGGTCGCAACCTCGCAATTCTATCCCTCCAACCTCCCTCGAATTTTT - AAAGCGTGAAGACTTGCAGGCATTGGTACGTTATTAGTCCAGTGGGGCCACAACCGTAACATTGCGTGTGACTGGTGCTTAGCGGGTGACGGCGTTCAGGTTACGCCCTCTGTGCATCACCGATTAGCGTTGTCTGAGCTTTCTAACGTCTCAAACCTGCTTGCGCCCTACGGTTTCTCTATAGTATCACGAAAGGGTCTGGTCGCAACCTCGCAATTCTATCCCTCCAACCTCCCTTGAATTTTTCTA - -com.milaboratory.core.alignment.BandedLinearAlignerTest > testGlobal1 STANDARD_OUT - 1 AATTGACA 8 - |||||| - 0 TATTGACT 7 - -com.milaboratory.core.alignment.BandedLinearAlignerTest > testGlobal2 STANDARD_OUT - 1 AATTGACAG 9 - |||||| | - 0 TATTGAC-G 7 - -com.milaboratory.core.alignment.BandedLinearAlignerTest > testGlobal3 STANDARD_OUT - 0 TATTGACT 7 - |||||| - 1 AATTGACA 8 - -com.milaboratory.core.alignment.BandedLinearAlignerTest > testGlobal4 STANDARD_OUT - 0 TATTGAC-G 7 - |||||| | - 1 AATTGACAG 9 - -com.milaboratory.core.alignment.kaligner1.KMapperTest > testBestOffset2 STANDARD_OUT - -205 - -com.milaboratory.core.alignment.kaligner1.KAlignerTest > testRandomCorrectness STANDARD_OUT - C=1182;I=0;M=0;ScE=0;R=0.0 AlignmentTime = 189.56us - C=1642;I=1;M=0;ScE=0;R=0.0 AlignmentTime = 92.48us - C=2048;I=0;M=0;ScE=0;R=0.0 AlignmentTime = 72.71us - C=2142;I=0;M=0;ScE=0;R=8.333333333333333E-7 AlignmentTime = 73.36us - -com.milaboratory.core.alignment.kaligner1.KAlignerTest > testRandom1 STANDARD_OUT - ##teamcity[buildStatisticValue key='kmFound' value='0.9449'] - ##teamcity[buildStatisticValue key='kmWrong' value='1.0E-4'] - ##teamcity[buildStatisticValue key='kmFalse' value='0.0058'] - -com.milaboratory.core.alignment.kaligner1.KAlignerTest > testRandomCorrectnessConcurrent STANDARD_OUT - C=2999;I=0;M=0;ScE=0;R=0.0 AlignmentTime = 79.73us - C=2998;I=0;M=0;ScE=1;R=0.0 AlignmentTime = 84.52us - C=2998;I=0;M=0;ScE=0;R=0.0 AlignmentTime = 85.10us - C=2998;I=0;M=2;ScE=0;R=0.0 AlignmentTime = 82.17us - com.milaboratory.core.alignment.MultiAlignmentHelperTest > test1 STANDARD_OUT 8 AGACACAGATACA 20 ||||||| ||||| @@ -4669,186 +4050,88 @@ 0 cgatccTTcggtgacaaagcgttcggacc 28 0 catcAggtatcgccctggtacg 21 -com.milaboratory.core.alignment.AlignmentTrimmerTest > testRandom1 STANDARD_OUT - lTrimmed = 1673 - rTrimmed = 1682 - lTrimmed = 2846 - rTrimmed = 2787 - -com.milaboratory.core.alignment.batch.SimpleBatchAlignerTest > test1 STANDARD_OUT - 4 hits. - -com.milaboratory.core.alignment.blast.BlastDBBuilderTest > test1 SKIPPED - -com.milaboratory.core.alignment.blast.BlastAlignerTest > test1 SKIPPED - -com.milaboratory.core.alignment.blast.BlastAlignerTest > simpleRandomTestT1 SKIPPED - -com.milaboratory.core.alignment.blast.BlastAlignerTest > simpleRandomTestT2 SKIPPED - -com.milaboratory.core.alignment.blast.BlastAlignerTest > simpleRandomTestT3 SKIPPED - -com.milaboratory.core.alignment.blast.BlastAlignerExtTest > test16SMicrobial1 SKIPPED - -com.milaboratory.core.alignment.blast.BlastAlignerExtTest > test1 SKIPPED - -com.milaboratory.core.alignment.kaligner2.KAligner2Test > testBoundaries STANDARD_OUT - 4962 - -com.milaboratory.core.alignment.kaligner2.KAligner2Test > caseJ1 STANDARD_OUT - 52 - 0 TGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGGA 51 - ||||||||||||||||||||||||||||||||||||||||||||||||||| - 55 TGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGGG 106 - [S51:A->G] - (0->52) - (55->107) - -com.milaboratory.core.alignment.kaligner2.KAligner2Test > testCase0 SKIPPED - -com.milaboratory.core.alignment.kaligner2.KAligner2Test > testSimpleRandomTest STANDARD_OUT - Time per query: 359.10us - Processed queries: 127 - Bad percent: 0.0 - False positive percent: 0.5823263939438055 - Scoring error percent: 0.7874015748031495 - -com.milaboratory.core.alignment.kaligner2.OffsetPacksAccumulatorTest > testScoreCorrection2 SKIPPED - -com.milaboratory.core.alignment.kaligner2.KMapper2Test > test11112 STANDARD_OUT - ID: 0 - Score: 1815 - Cluster 0: - Q 27 -> T 15 - -12 - Q 30 -> T 18 - -12 - Q 36 -> T 25 - -11 - Q 39 -> T 28 - -11 - Q 42 -> T 31 - -11 - Q 45 -> T 34 - -11 - Q 48 -> T 37 - -11 - Q 51 -> T 40 - -11 - Cluster 1: - Q 84 -> T 50 - -34 - Q 87 -> T 53 - -34 - Q 90 -> T 56 - -34 - Q 93 -> T 59 - -34 - Q 96 -> T 62 - -34 - Q 99 -> T 65 - -34 - Q 111 -> T 79 - -32 - Q 114 -> T 82 - -32 - Q 117 -> T 85 - -32 - Cluster 2: - Q 150 -> T 92 - -58 - Q 153 -> T 95 - -58 - Q 156 -> T 98 - -58 - Q 159 -> T 101 - -58 - Cluster 3: - Q 198 -> T 120 - -78 - Q 201 -> T 123 - -78 - Q 204 -> T 126 - -78 - Q 207 -> T 129 - -78 - Q 216 -> T 139 - -77 - Q 219 -> T 142 - -77 - Q 231 -> T 153 - -78 - Q 234 -> T 156 - -78 - Q 237 -> T 159 - -78 - Q 240 -> T 162 - -78 - Cluster 4: - Q 246 -> T 178 - -68 - Q 249 -> T 181 - -68 - Q 252 -> T 184 - -68 - Q 255 -> T 187 - -68 - Q 258 -> T 190 - -68 - Q 261 -> T 193 - -68 - Q 262 -> T 194 - -68 - +com.milaboratory.core.alignment.AlignmentHelperTest > test1 STANDARD_OUT + 0 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGC 29 + |||||||||||||||||||||||||||||| + 0 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGC 29 -com.milaboratory.core.alignment.kaligner2.KMapper2Test > test1111 STANDARD_OUT - ID: 0 - Score: 1206 - Cluster 0: - Q 9 -> T 15 - 6 - Q 12 -> T 18 - 6 - Q 15 -> T 21 - 6 - Q 18 -> T 24 - 6 - Q 21 -> T 27 - 6 - Q 24 -> T 30 - 6 - Q 27 -> T 33 - 6 - Q 30 -> T 36 - 6 - Cluster 1: - Q 57 -> T 48 - -9 - Q 69 -> T 61 - -8 - Q 78 -> T 69 - -9 - Q 81 -> T 72 - -9 - Q 84 -> T 75 - -9 - Q 87 -> T 78 - -9 - Cluster 2: - Q 123 -> T 89 - -34 - Q 126 -> T 92 - -34 - Q 129 -> T 95 - -34 - Q 132 -> T 98 - -34 - Q 150 -> T 116 - -34 - Q 168 -> T 132 - -36 - Q 171 -> T 135 - -36 - Q 174 -> T 138 - -36 - Q 177 -> T 141 - -36 - Q 180 -> T 144 - -36 - Q 183 -> T 147 - -36 - Q 185 -> T 149 - -36 + 30 TTGGT-ACAGCCTGGGGGGTCCCTGAGACT 58 + |||| | |||||||||||||| |||||| + 30 CTGGTCA-AGCCTGGGGGGTCCATGAGACA 58 + 59 CTCCTGTGCAGCCTCTGGATTCACCTTCAG 88 + |||||||||||||||||||||| ||||||| + 59 CTCCTGTGCAGCCTCTGGATTCCCCTTCAG 88 -com.milaboratory.core.alignment.kaligner2.KMapper2Test > testRandom1 STANDARD_OUT - noHits: 304 - noHits2: 0 - noHits3: 0 - wrongTopHit: 35 - wrongTopHitS: 27 - noCorrectHitInList: 21 + 89 TAGC-TATAGCATGAACTGGGTCCGCCAGG 117 + || | ||||||||||||||||||||||||| + 89 TA-CTTATAGCATGAACTGGGTCCGCCAGG 117 + 118 CTCCAGGGAAGGGGCTGGAGTGGGTTTCAT 147 + ||||||||||||||||||||||||| |||| + 118 CTCCAGGGAAGGGGCTGGAGTGGGTCTCAT 147 + 148 ACATTAGTAGTAGTAGTAG-TACCATATAC 176 + |||||||||| ||||||| || |||||| + 148 CCATTAGTAGTGGTAGTAGTTA-CATATAT 176 + 177 TACGCAGACTCTGTGAAGGGCCGATTCACC 206 + ||||||||||| |||||||||||||||||| + 177 TACGCAGACTCCGTGAAGGGCCGATTCACC 206 - Timings: - DescriptiveStatistics: - n: 100000 - min: 4887.0 - max: 1.17337632E8 - mean: 67018.68202000036 - std dev: 1068581.8007186968 - median: 52488.0 - skewness: 101.1573231073808 - kurtosis: 10314.128961963055 + 207 ATCTCCAGAGACAATGCCAAGAACTCACTG 236 + |||||||||||||| ||||||||||||||| + 207 ATCTCCAGAGACAACGCCAAGAACTCACTG 236 + 237 TATCTGCAAATGAACAGCCTGAGAGACGAG 266 + ||||||||||||||||||||||||| |||| + 237 TATCTGCAAATGAACAGCCTGAGAGCCGAG 266 + 267 GACACGGCTGTGTATTACTGTGC 289 + ||||||||||||||||||||||| + 267 GACACGGCTGTGTATTACTGTGC 289 +com.milaboratory.core.alignment.AlignmentTrimmerTest > testRandom1 STANDARD_OUT + lTrimmed = 1718 + rTrimmed = 1687 + lTrimmed = 2787 + rTrimmed = 2778 - Clusters basicSize - DescriptiveStatistics: - n: 99661 - min: 1.0 - max: 6.0 - mean: 2.849640280551075 - std dev: 1.1010998260155302 - median: 3.0 - skewness: 0.3115804057631202 - kurtosis: -0.6683366068852421 +com.milaboratory.core.alignment.AlignmentIteratorTest > test1 STANDARD_OUT + 0 -ATT-AGACA-- 7 + ||| || | + 0 AATTGGGA-ATT 10 + I0AI3GSA3GDC6I8TI8T +com.milaboratory.core.alignment.BandedLinearAlignerTest > testCase1 STANDARD_OUT + GCGTGAAGACTGCAGGCATTGAGTACGTTACTAGTCCAGTGGGGCCCAACCGTAACATTGCGTGTGACTGGTTGCTTAGCGGGTGACGGCGTTTCAGGTTACGCCCTCTGTGCATCACCGATAGCGTTGTTTGAGCTTTCTAACGTCTCAAACCTGCTTGCGCCCTACGGTTTCTCTATATATACACGAAAGGGGCTGGTCGCAACCTCGCAATTCTATCCCTCCAACCTCCCTCGAATTTTT + AAAGCGTGAAGACTTGCAGGCATTGGTACGTTATTAGTCCAGTGGGGCCACAACCGTAACATTGCGTGTGACTGGTGCTTAGCGGGTGACGGCGTTCAGGTTACGCCCTCTGTGCATCACCGATTAGCGTTGTCTGAGCTTTCTAACGTCTCAAACCTGCTTGCGCCCTACGGTTTCTCTATAGTATCACGAAAGGGTCTGGTCGCAACCTCGCAATTCTATCCCTCCAACCTCCCTTGAATTTTTCTA +com.milaboratory.core.alignment.BandedLinearAlignerTest > testGlobal1 STANDARD_OUT + 1 AATTGACA 8 + |||||| + 0 TATTGACT 7 +com.milaboratory.core.alignment.BandedLinearAlignerTest > testGlobal2 STANDARD_OUT + 1 AATTGACAG 9 + |||||| | + 0 TATTGAC-G 7 +com.milaboratory.core.alignment.BandedLinearAlignerTest > testGlobal3 STANDARD_OUT + 0 TATTGACT 7 + |||||| + 1 AATTGACA 8 - Top Delta - DescriptiveStatistics: - n: 99675 - min: -24.0 - max: 0.0 - mean: -7.223476297969686E-4 - std dev: 0.11252001585357393 - median: 0.0 - skewness: -181.13235380868926 - kurtosis: 34883.26157247137 +com.milaboratory.core.alignment.BandedLinearAlignerTest > testGlobal4 STANDARD_OUT + 0 TATTGAC-G 7 + |||||| | + 1 AATTGACAG 9 +com.milaboratory.core.alignment.AlignerTest > testCalculateScore1 STANDARD_OUT + 3.71us + 3.64us + 2.95us com.milaboratory.core.alignment.AlignerCustomTest > testSemiLocal0 STANDARD_OUT 29.0 @@ -4888,588 +4171,1312 @@ 0 GATAC-----ATTAGA---CACAGATACA 20 -com.milaboratory.core.alignment.AlignerTest > testCalculateScore1 STANDARD_OUT - 1.32us - 1.31us - 1.31us - -com.milaboratory.core.alignment.AlignmentIteratorTest > test1 STANDARD_OUT - 0 -ATT-AGACA-- 7 - ||| || | - 0 AATTGGGA-ATT 10 - I0AI3GSA3GDC6I8TI8T +com.milaboratory.core.io.sequence.fasta.RandomAccessFastaReaderTest > test1nt STANDARD_ERROR + Indexing milib_6c36b2abb2dae26457339a7705918695366171478742424888556210820.fasta: 0% + Indexing milib_6c36b2abb2dae26457339a7705918695366171478742424888556210820.fasta: done -com.milaboratory.test.TestUtil > testLT STANDARD_OUT - Short tests. - No system env properties. +com.milaboratory.core.io.sequence.fasta.RandomAccessFastaReaderTest > test1 STANDARD_ERROR + Indexing milib_6c36b2abb2dae26457339a7705918695366171478742424888556210820.fasta: 0% + Indexing milib_6c36b2abb2dae26457339a7705918695366171478742424888556210820.fasta: done -com.milaboratory.primitivio.blocks.PrimitivOBlocksTest > benchmark1 SKIPPED +com.milaboratory.core.io.sequence.fasta.RandomAccessFastaReaderTest > test2 STANDARD_ERROR + Indexing milib_b1d9e553fac5f1085e5c8215db0990cd7d8a802f11803575410228332025.tmp: 0% + Indexing milib_b1d9e553fac5f1085e5c8215db0990cd7d8a802f11803575410228332025.tmp: done -com.milaboratory.primitivio.blocks.PrimitivOBlocksTest > test1 STANDARD_OUT +com.milaboratory.core.io.util.IOUtilTest > test111 STANDARD_OUT + 3 + 3 + -2147483648 + -9223372036854775808 - ================== - High compression: false - Concurrency: 4 - File size: 6799510 - Write time: 67.93ms +com.milaboratory.core.tree.PrimerGenerator > generate SKIPPED - O. Stats: - Wall clock time: 68.24ms - Total CPU time: 134.69ms - User wait time: 48.36ms - Serialization time: 88.37ms (65.62%) - Checksum calculation time: 3.79ms (2.81%) - Compression time: 39.08ms (29.02%) - Total IO delay: 11.35ms - Concurrency overhead: 3.28ms - Uncompressed size: 18.44MiB (~2.08KiB per object) - Output size: 6.48MiB (~748B per object; compression = 35.17%) - IO speed: 589.5MiB/s - Concurrency adjusted uncompressed speed: 472.74MiB/s - Actual uncompressed speed: 271.13MiB/s - Actual speed: 95.36MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 62 (~107.1KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 +com.milaboratory.core.tree.SequenceTreeMapTest > testCase9 STANDARD_OUT + Hit 1 + 0 ac-gacTtgactg 11 + 0 acTgac-tgactg 11 - I. Stats 1: - Wall clock time: 39.09ms - Total CPU time: 69.45ms - Serialization time: 26.54ms (38.22%) - Checksum calculation time: 5.8ms (8.35%) - Compression time: 35.9ms (51.69%) - Total IO delay: 5.11ms - Input size: 6.48MiB - Decompressed size: 18.44MiB (compression = 35.17%) - IO speed: 1.27GiB/s - Concurrency adjusted uncompressed speed: 1GiB/s - Actual uncompressed speed: 472.74MiB/s - Actual speed: 166.27MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 62 (~107.1KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + Hit 2 + 0 ac-gactTgactg 11 + 0 acTgact-gactg 11 - I. Stats 2: - Wall clock time: 96.1ms - Total CPU time: 134.48ms - Serialization time: 51.26ms (38.12%) - Checksum calculation time: 9.33ms (6.94%) - Compression time: 71.76ms (53.36%) - Total IO delay: 9.38ms - Input size: 12.97MiB - Decompressed size: 36.87MiB (compression = 35.17%) - IO speed: 1.41GiB/s - Concurrency adjusted uncompressed speed: 1.03GiB/s - Actual uncompressed speed: 384.1MiB/s - Actual speed: 135.09MiB/s - Objects: 18158 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 124 (~107.1KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - ================== - High compression: false - Concurrency: 4 - File size: 6791878 - Write time: 61.98ms - - O. Stats: - Wall clock time: 62.14ms - Total CPU time: 85.1ms - User wait time: 49.78ms - Serialization time: 48.05ms (56.46%) - Checksum calculation time: 3.44ms (4.04%) - Compression time: 30.96ms (36.39%) - Total IO delay: 9.14ms - Concurrency overhead: 431.37us - Uncompressed size: 18.44MiB (~2.08KiB per object) - Output size: 6.48MiB (~748B per object; compression = 35.13%) - IO speed: 719.69MiB/s - Concurrency adjusted uncompressed speed: 801.6MiB/s - Actual uncompressed speed: 297.37MiB/s - Actual speed: 104.47MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 20 (~331.63KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 +com.milaboratory.core.tree.SequenceTreeMapTest > optimalityAndScopeTest STANDARD_OUT + --NW alignments-- + CASSLAPGATN-KLFF + CASS-APGATNEKLFF - I. Stats 1: - Wall clock time: 51.49ms - Total CPU time: 74.58ms - Serialization time: 35.35ms (47.39%) - Checksum calculation time: 3.5ms (4.69%) - Compression time: 35.62ms (47.75%) - Total IO delay: 4.33ms - Input size: 6.48MiB - Decompressed size: 18.44MiB (compression = 35.13%) - IO speed: 1.58GiB/s - Concurrency adjusted uncompressed speed: 970.36MiB/s - Actual uncompressed speed: 361.51MiB/s - Actual speed: 127MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 20 (~331.63KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + CASSLAPGATN-KLFF + CASSLAPG-TNEKLFF - I. Stats 2: - Wall clock time: 101.67ms - Total CPU time: 134.18ms - Serialization time: 55.52ms (41.38%) - Checksum calculation time: 7.06ms (5.26%) - Compression time: 71.38ms (53.2%) - Total IO delay: 7.77ms - Input size: 12.95MiB - Decompressed size: 36.87MiB (compression = 35.13%) - IO speed: 1.81GiB/s - Concurrency adjusted uncompressed speed: 1.03GiB/s - Actual uncompressed speed: 365.09MiB/s - Actual speed: 128.26MiB/s - Objects: 18158 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 40 (~331.63KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + CASSLAPGATN-KLfF + CASSLAPG-TNEKLyF - ================== - High compression: false - Concurrency: 1 - File size: 6799510 - Write time: 77.92ms + --STM alignments-- + CASSLAPGATN-KLFF + CASS-APGATNEKLFF - O. Stats: - Wall clock time: 78.35ms - Total CPU time: 61.01ms - User wait time: 70.45ms - Serialization time: 23.33ms (38.24%) - Checksum calculation time: 3.47ms (5.69%) - Compression time: 30.78ms (50.44%) - Total IO delay: 8.93ms - Concurrency overhead: 1.26ms - Uncompressed size: 18.44MiB (~2.08KiB per object) - Output size: 6.48MiB (~748B per object; compression = 35.17%) - IO speed: 810.56MiB/s - Concurrency adjusted uncompressed speed: 259.67MiB/s - Actual uncompressed speed: 236.37MiB/s - Actual speed: 83.13MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 62 (~107.1KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Checksum ok! + CASSLAPGATN-KLFF + CASSLAPG-TNEKLFF - I. Stats 1: - Wall clock time: 37.64ms - Total CPU time: 58ms - Serialization time: 18.09ms (31.19%) - Checksum calculation time: 3.49ms (6.02%) - Compression time: 35.81ms (61.74%) - Total IO delay: 4.72ms - Input size: 6.48MiB - Decompressed size: 18.44MiB (compression = 35.17%) - IO speed: 1.58GiB/s - Concurrency adjusted uncompressed speed: 297.37MiB/s - Actual uncompressed speed: 498.29MiB/s - Actual speed: 175.26MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 62 (~107.1KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + CASSlAPGATN-KLFF + CASSa-PGATNEKLFF - I. Stats 2: - Wall clock time: 75.07ms - Total CPU time: 115.84ms - Serialization time: 35.91ms (31%) - Checksum calculation time: 6.98ms (6.03%) - Compression time: 71.48ms (61.7%) - Total IO delay: 8.73ms - Input size: 12.97MiB - Decompressed size: 36.87MiB (compression = 35.17%) - IO speed: 1.58GiB/s - Concurrency adjusted uncompressed speed: 297.37MiB/s - Actual uncompressed speed: 491.65MiB/s - Actual speed: 172.92MiB/s - Objects: 18158 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 124 (~107.1KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + CASSLAPGaTN-KLFF + CASSLAPGt-NEKLFF - ================== - High compression: false - Concurrency: 1 - File size: 6791878 - Write time: 75.35ms + CASSlAPGATN-KLFF + CA-SsAPGATNEKLFF - O. Stats: - Wall clock time: 75.78ms - Total CPU time: 61.21ms - User wait time: 68.76ms - Serialization time: 24.09ms (39.36%) - Checksum calculation time: 3.46ms (5.65%) - Compression time: 31.01ms (50.66%) - Total IO delay: 7.45ms - Concurrency overhead: 381.93us - Uncompressed size: 18.44MiB (~2.08KiB per object) - Output size: 6.48MiB (~748B per object; compression = 35.13%) - IO speed: 925.32MiB/s - Concurrency adjusted uncompressed speed: 267.2MiB/s - Actual uncompressed speed: 245.83MiB/s - Actual speed: 86.36MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 20 (~331.63KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Checksum ok! + CASSlAPGATN-KLFF + CAS-sAPGATNEKLFF - I. Stats 1: - Wall clock time: 40.18ms - Total CPU time: 56.67ms - Serialization time: 16.3ms (28.76%) - Checksum calculation time: 3.45ms (6.09%) - Compression time: 36.79ms (64.91%) - Total IO delay: 4.5ms - Input size: 6.48MiB - Decompressed size: 18.44MiB (compression = 35.13%) - IO speed: 1.58GiB/s - Concurrency adjusted uncompressed speed: 302.24MiB/s - Actual uncompressed speed: 460.92MiB/s - Actual speed: 161.93MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 20 (~331.63KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + CASSLAPGATNk-LFF + CASS-APGATNeKLFF - I. Stats 2: - Wall clock time: 85.21ms - Total CPU time: 112.39ms - Serialization time: 32.65ms (29.05%) - Checksum calculation time: 6.91ms (6.15%) - Compression time: 72.57ms (64.57%) - Total IO delay: 7.91ms - Input size: 12.95MiB - Decompressed size: 36.87MiB (compression = 35.13%) - IO speed: 1.81GiB/s - Concurrency adjusted uncompressed speed: 307.28MiB/s - Actual uncompressed speed: 433.81MiB/s - Actual speed: 152.41MiB/s - Objects: 18158 - Average object size uncompressed: 2.08KiB - Average object size compressed: 748B - Blocks: 40 (~331.63KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + CASSLAPGaTN-KLFF + CASSLAP-gTNEKLFF - ================== - High compression: true - Concurrency: 4 - File size: 4156299 - Write time: 1.09s + CASSLAPGATNk-LFF + CASSLAPG-TNeKLFF - O. Stats: - Wall clock time: 1.09s - Total CPU time: 2.85s - User wait time: 1.03s - Serialization time: 23.67ms (0.83%) - Checksum calculation time: 3.53ms (0.12%) - Compression time: 2.82s (98.91%) - Total IO delay: 8.19ms - Concurrency overhead: 1.46ms - Uncompressed size: 18.44MiB (~2.08KiB per object) - Output size: 3.96MiB (~457B per object; compression = 21.5%) - IO speed: 495.47MiB/s - Concurrency adjusted uncompressed speed: 25.79MiB/s - Actual uncompressed speed: 16.88MiB/s - Actual speed: 3.63MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 457B - Blocks: 62 (~65.47KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + CASSLAPGATN-KLfF + CASSLAPG-TNEKLyF - I. Stats 1: - Wall clock time: 28.13ms - Total CPU time: 53.22ms - Serialization time: 16.72ms (31.41%) - Checksum calculation time: 3.51ms (6.6%) - Compression time: 32.41ms (60.89%) - Total IO delay: 3.58ms - Input size: 3.96MiB - Decompressed size: 18.44MiB (compression = 21.5%) - IO speed: 1.29GiB/s - Concurrency adjusted uncompressed speed: 1.29GiB/s - Actual uncompressed speed: 658.46MiB/s - Actual speed: 141.56MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 457B - Blocks: 62 (~65.47KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 + ------------------ - I. Stats 2: - Wall clock time: 62.5ms - Total CPU time: 106.49ms - Serialization time: 33.38ms (31.34%) - Checksum calculation time: 7ms (6.57%) - Compression time: 64.92ms (60.97%) - Total IO delay: 6.73ms - Input size: 7.93MiB - Decompressed size: 36.87MiB (compression = 21.5%) - IO speed: 1.29GiB/s - Concurrency adjusted uncompressed speed: 1.29GiB/s - Actual uncompressed speed: 594.74MiB/s - Actual speed: 127.86MiB/s - Objects: 18158 - Average object size uncompressed: 2.08KiB - Average object size compressed: 457B - Blocks: 124 (~65.47KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 +com.milaboratory.core.merger.MergerParametersTest > test2 STANDARD_OUT + { + "qualityMergingAlgorithm": "SumSubtraction", + "partsLayout": "Collinear", + "minimalOverlap": 15, + "maxQuality": 50, + "minimalIdentity": 0.8, + "identityType": "Unweighted" + } - ================== - High compression: true - Concurrency: 4 - File size: 4098671 - Write time: 1.76s +com.milaboratory.util.sorting.HashSorterTest > testSingleton STANDARD_OUT + /tmp/milib_cf705f3f4e614b40f9b2fbd55db51517b0975de912536711724223220306 + timeInCollate: 6.59s + timeInCollatorInit: 4.36s + timeAwaitingO: 2.33ms + timeAwaitingI: 935.07ms + timeInFinalSorting1: 0ns + timeInFinalSorting2: 30.76ms + timeInFinalSorting3: 92.35ms + /22S (5|27|32): objs=50000 size=2.95MiB - O. Stats: - Wall clock time: 1.76s - Total CPU time: 2.92s - User wait time: 1.59s - Serialization time: 23.83ms (0.81%) - Checksum calculation time: 3.47ms (0.12%) - Compression time: 2.89s (98.97%) - Total IO delay: 6.22ms - Concurrency overhead: 621.64us - Uncompressed size: 18.44MiB (~2.08KiB per object) - Output size: 3.91MiB (~451B per object; compression = 21.2%) - IO speed: 651.47MiB/s - Concurrency adjusted uncompressed speed: 25.15MiB/s - Actual uncompressed speed: 10.46MiB/s - Actual speed: 2.22MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 451B - Blocks: 20 (~200.13KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 +com.milaboratory.util.sorting.HashSorterTest > test1 STANDARD_OUT + /tmp/milib_e7a9ff47955f1533d3b9d265518e40600c1a17a57968637814306558778 + timeInCollate: 31.67s + timeInCollatorInit: 6.14s + timeAwaitingO: 834.27ms + timeAwaitingI: 9.96s + timeInFinalSorting1: 4.59s + timeInFinalSorting2: 1.18s + timeInFinalSorting3: 1.13s + /0N (5|27|32): objs=155525 size=8.6MiB + /1N (5|27|32): objs=152815 size=8.41MiB + /2N (5|27|32): objs=153845 size=8.94MiB + /3N (5|27|32): objs=152456 size=8.49MiB + /4N (5|27|32): objs=160226 size=8.86MiB + /5N (5|27|32): objs=157141 size=8.94MiB + /6N (5|27|32): objs=155767 size=8.96MiB + /7N (5|27|32): objs=149979 size=8.33MiB + /8N (5|27|32): objs=156455 size=9MiB + /9N (5|27|32): objs=152873 size=8.5MiB + /10N (5|27|32): objs=159609 size=9.26MiB + /11N (5|27|32): objs=155155 size=9.01MiB + /12N (5|27|32): objs=155235 size=8.83MiB + /13N (5|27|32): objs=153033 size=8.54MiB + /14N (5|27|32): objs=156868 size=8.73MiB + /15N (5|27|32): objs=152840 size=8.62MiB + /16N (5|27|32): objs=154369 size=8.51MiB + /17N (5|27|32): objs=153783 size=8.86MiB + /18N (5|27|32): objs=156888 size=9MiB + /19N (5|27|32): objs=158346 size=9MiB + /20N (5|27|32): objs=162205 size=9.22MiB + /21N (5|27|32): objs=162815 size=9.39MiB + /22N (5|27|32): objs=160745 size=9.14MiB + /23N (5|27|32): objs=157083 size=8.57MiB + /24N (5|27|32): objs=153127 size=8.55MiB + /25N (5|27|32): objs=156869 size=8.81MiB + /26N (5|27|32): objs=160210 size=9.22MiB + /27N (5|27|32): objs=153310 size=8.83MiB + /28N (5|27|32): objs=157185 size=8.94MiB + /29N (5|27|32): objs=152716 size=8.58MiB + /30N (5|27|32): objs=161961 size=9.11MiB + /31N (5|27|32): objs=158566 size=9.02MiB + /0/0N (2|25|36): objs=38644 size=796.21KiB + /0/1N (2|25|36): objs=37017 size=721.72KiB + /0/2N (2|25|36): objs=37485 size=702.98KiB + /0/3N (2|25|36): objs=8983 size=49.67KiB + /0/4S (2|25|36): objs=160 size=165B + /0/5N (2|25|36): objs=1796 size=7.43KiB + /0/6S (2|25|36): objs=139 size=119B + /0/7N (2|25|36): objs=4258 size=20.07KiB + /0/8S (2|25|36): objs=151 size=308B + /0/9N (2|25|36): objs=919 size=3.88KiB + /0/10S (2|25|36): objs=167 size=197B + /0/11N (2|25|36): objs=1137 size=4.78KiB + /0/12S (2|25|36): objs=139 size=297B + /0/13N (2|25|36): objs=1495 size=6.55KiB + /0/14S (2|25|36): objs=141 size=96B + /0/15N (2|25|36): objs=3760 size=16.9KiB + /0/16S (2|25|36): objs=141 size=233B + /0/17N (2|25|36): objs=3536 size=15.12KiB + /0/18S (2|25|36): objs=148 size=198B + /0/19N (2|25|36): objs=1199 size=4.9KiB + /0/20S (2|25|36): objs=144 size=318B + /0/21N (2|25|36): objs=416 size=1.54KiB + /0/22S (2|25|36): objs=187 size=309B + /0/23N (2|25|36): objs=4384 size=19.54KiB + /0/24S (2|25|36): objs=149 size=289B + /0/25S (2|25|36): objs=152 size=285B + /0/26S (2|25|36): objs=185 size=329B + /0/27N (2|25|36): objs=1089 size=4.19KiB + /0/28S (2|25|36): objs=159 size=298B + /0/29S (2|25|36): objs=133 size=276B + /0/30S (2|25|36): objs=170 size=348B + /0/31N (2|25|36): objs=3388 size=15.52KiB + /0/32S (2|25|36): objs=135 size=169B + /0/33N (2|25|36): objs=1201 size=4.56KiB + /0/34S (2|25|36): objs=162 size=97B + /0/35N (2|25|36): objs=2056 size=8.63KiB + /1/0N (2|25|36): objs=38186 size=866.03KiB + /1/1N (2|25|36): objs=37862 size=760.89KiB + /1/2N (2|25|36): objs=12282 size=67.97KiB + /1/3S (2|25|36): objs=164 size=126B + /1/4N (2|25|36): objs=15909 size=95.65KiB + /1/5S (2|25|36): objs=158 size=347B + /1/6N (2|25|36): objs=10788 size=59.29KiB + /1/7S (2|25|36): objs=148 size=153B + /1/8S (2|25|36): objs=171 size=272B + /1/9S (2|25|36): objs=130 size=229B + /1/10N (2|25|36): objs=316 size=1.01KiB + /1/11N (2|25|36): objs=2622 size=11.48KiB + /1/12S (2|25|36): objs=149 size=251B + /1/13N (2|25|36): objs=740 size=2.92KiB + /1/14S (2|25|36): objs=179 size=221B + /1/15N (2|25|36): objs=2596 size=11.06KiB + /1/16S (2|25|36): objs=148 size=130B + /1/18S (2|25|36): objs=153 size=142B + /1/19N (2|25|36): objs=7618 size=36.52KiB + /1/20S (2|25|36): objs=126 size=142B + /1/21N (2|25|36): objs=1364 size=5.7KiB + /1/22S (2|25|36): objs=166 size=193B + /1/23N (2|25|36): objs=324 size=936B + /1/24S (2|25|36): objs=161 size=348B + /1/25N (2|25|36): objs=4101 size=19.79KiB + /1/26S (2|25|36): objs=161 size=267B + /1/27N (2|25|36): objs=802 size=2.98KiB + /1/28S (2|25|36): objs=148 size=334B + /1/29N (2|25|36): objs=1534 size=6.31KiB + /1/30S (2|25|36): objs=150 size=221B + /1/31N (2|25|36): objs=598 size=2.03KiB + /1/32S (2|25|36): objs=152 size=180B + /1/33N (2|25|36): objs=11942 size=71.68KiB + /1/34S (2|25|36): objs=140 size=182B + /1/35N (2|25|36): objs=627 size=2.23KiB + /2/0N (2|25|36): objs=13106 size=82.15KiB + /2/1S (2|25|36): objs=168 size=268B + /2/2N (2|25|36): objs=20319 size=235.81KiB + /2/3N (2|25|36): objs=41737 size=1008.13KiB + /2/4N (2|25|36): objs=37064 size=826.13KiB + /2/5N (2|25|36): objs=16162 size=144.09KiB + /2/6S (2|25|36): objs=164 size=336B + /2/7N (2|25|36): objs=2237 size=9.38KiB + /2/8S (2|25|36): objs=172 size=210B + /2/9N (2|25|36): objs=3226 size=14.02KiB + /2/10S (2|25|36): objs=158 size=318B + /2/11N (2|25|36): objs=880 size=3.54KiB + /2/12S (2|25|36): objs=146 size=256B + /2/13N (2|25|36): objs=934 size=3.71KiB + /2/14S (2|25|36): objs=184 size=366B + /2/15N (2|25|36): objs=2884 size=12.23KiB + /2/16S (2|25|36): objs=141 size=92B + /2/17N (2|25|36): objs=434 size=1.51KiB + /2/18S (2|25|36): objs=149 size=274B + /2/20S (2|25|36): objs=131 size=261B + /2/21N (2|25|36): objs=3118 size=13.47KiB + /2/22S (2|25|36): objs=150 size=141B + /2/23N (2|25|36): objs=787 size=2.87KiB + /2/24S (2|25|36): objs=158 size=330B + /2/25N (2|25|36): objs=2779 size=11.78KiB + /2/26S (2|25|36): objs=152 size=121B + /2/27N (2|25|36): objs=924 size=3.67KiB + /2/28S (2|25|36): objs=148 size=332B + /2/29N (2|25|36): objs=2611 size=11.37KiB + /2/30S (2|25|36): objs=151 size=196B + /2/31S (2|25|36): objs=169 size=142B + /2/32S (2|25|36): objs=164 size=93B + /2/33N (2|25|36): objs=1986 size=8.15KiB + /2/34S (2|25|36): objs=152 size=125B + /3/0N (2|25|36): objs=37632 size=878.7KiB + /3/1N (2|25|36): objs=23673 size=344.33KiB + /3/2S (2|25|36): objs=170 size=189B + /3/3N (2|25|36): objs=16262 size=108.02KiB + /3/4N (2|25|36): objs=34627 size=594.66KiB + /3/5N (2|25|36): objs=12143 size=77.76KiB + /3/6S (2|25|36): objs=190 size=150B + /3/7N (2|25|36): objs=4469 size=20.25KiB + /3/8S (2|25|36): objs=158 size=292B + /3/9N (2|25|36): objs=1187 size=4.82KiB + /3/10S (2|25|36): objs=161 size=205B + /3/11N (2|25|36): objs=487 size=1.54KiB + /3/12S (2|25|36): objs=179 size=165B + /3/13N (2|25|36): objs=793 size=3.19KiB + /3/14S (2|25|36): objs=156 size=253B + /3/15N (2|25|36): objs=2154 size=8.83KiB + /3/16S (2|25|36): objs=158 size=310B + /3/17S (2|25|36): objs=155 size=186B + /3/18S (2|25|36): objs=148 size=93B + /3/19N (2|25|36): objs=1867 size=7.55KiB + /3/20S (2|25|36): objs=153 size=161B + /3/21N (2|25|36): objs=7261 size=38.64KiB + /3/22S (2|25|36): objs=138 size=282B + /3/23N (2|25|36): objs=909 size=3.5KiB + /3/24S (2|25|36): objs=145 size=278B + /3/25N (2|25|36): objs=2856 size=12.25KiB + /3/26S (2|25|36): objs=159 size=171B + /3/27N (2|25|36): objs=750 size=2.8KiB + /3/28S (2|25|36): objs=145 size=181B + /3/29N (2|25|36): objs=612 size=2.17KiB + /3/30S (2|25|36): objs=160 size=281B + /3/32S (2|25|36): objs=154 size=256B + /3/33N (2|25|36): objs=1056 size=4.35KiB + /3/34S (2|25|36): objs=144 size=196B + /3/35N (2|25|36): objs=1045 size=4.41KiB + /4/0N (2|25|36): objs=37290 size=759.27KiB + /4/1N (2|25|36): objs=42268 size=851.57KiB + /4/2N (2|25|36): objs=39692 size=862.44KiB + /4/3N (2|25|36): objs=9998 size=49.68KiB + /4/4S (2|25|36): objs=146 size=139B + /4/5S (2|25|36): objs=157 size=159B + /4/6S (2|25|36): objs=146 size=173B + /4/7N (2|25|36): objs=2740 size=11.82KiB + /4/8S (2|25|36): objs=157 size=183B + /4/9N (2|25|36): objs=306 size=813B + /4/10S (2|25|36): objs=162 size=106B + /4/12S (2|25|36): objs=148 size=117B + /4/13N (2|25|36): objs=3158 size=13.43KiB + /4/14S (2|25|36): objs=164 size=286B + /4/15N (2|25|36): objs=4664 size=21.91KiB + /4/16S (2|25|36): objs=151 size=121B + /4/17N (2|25|36): objs=1513 size=6.11KiB + /4/18S (2|25|36): objs=159 size=285B + /4/19N (2|25|36): objs=1415 size=5.82KiB + /4/20S (2|25|36): objs=142 size=172B + /4/21N (2|25|36): objs=1973 size=8.22KiB + /4/22S (2|25|36): objs=155 size=337B + /4/23N (2|25|36): objs=1693 size=7.06KiB + /4/24S (2|25|36): objs=152 size=315B + /4/25N (2|25|36): objs=5504 size=25.76KiB + /4/26S (2|25|36): objs=150 size=184B + /4/27N (2|25|36): objs=1822 size=7.66KiB + /4/28S (2|25|36): objs=140 size=333B + /4/29S (2|25|36): objs=143 size=295B + /4/30S (2|25|36): objs=153 size=132B + /4/31N (2|25|36): objs=2266 size=9.81KiB + /4/32S (2|25|36): objs=135 size=126B + /4/33N (2|25|36): objs=289 size=829B + /4/34S (2|25|36): objs=167 size=226B + /4/35N (2|25|36): objs=908 size=3.42KiB + /5/0N (2|25|36): objs=37977 size=746.11KiB + /5/1N (2|25|36): objs=37944 size=752.52KiB + /5/2N (2|25|36): objs=40550 size=928.42KiB + /5/3N (2|25|36): objs=7165 size=34.84KiB + /5/4S (2|25|36): objs=146 size=235B + /5/6S (2|25|36): objs=150 size=267B + /5/7N (2|25|36): objs=774 size=2.79KiB + /5/8S (2|25|36): objs=163 size=196B + /5/9N (2|25|36): objs=267 size=955B + /5/10S (2|25|36): objs=160 size=272B + /5/11N (2|25|36): objs=893 size=3.34KiB + /5/12S (2|25|36): objs=149 size=271B + /5/13S (2|25|36): objs=163 size=92B + /5/14S (2|25|36): objs=145 size=216B + /5/15N (2|25|36): objs=1084 size=4.19KiB + /5/16S (2|25|36): objs=168 size=202B + /5/17N (2|25|36): objs=8628 size=43.92KiB + /5/18S (2|25|36): objs=155 size=151B + /5/19N (2|25|36): objs=477 size=1.82KiB + /5/20S (2|25|36): objs=148 size=103B + /5/21N (2|25|36): objs=3535 size=15.07KiB + /5/22S (2|25|36): objs=151 size=195B + /5/23N (2|25|36): objs=957 size=3.69KiB + /5/24S (2|25|36): objs=150 size=170B + /5/25N (2|25|36): objs=931 size=3.61KiB + /5/26S (2|25|36): objs=163 size=106B + /5/27N (2|25|36): objs=3004 size=13.48KiB + /5/28S (2|25|36): objs=159 size=169B + /5/29N (2|25|36): objs=3678 size=17.67KiB + /5/30S (2|25|36): objs=177 size=93B + /5/31N (2|25|36): objs=3198 size=15.39KiB + /5/32S (2|25|36): objs=140 size=233B + /5/33N (2|25|36): objs=2614 size=10.95KiB + /5/34S (2|25|36): objs=153 size=94B + /5/35N (2|25|36): objs=825 size=2.88KiB + /6/0N (2|25|36): objs=34466 size=685.76KiB + /6/1N (2|25|36): objs=41559 size=1.02MiB + /6/2N (2|25|36): objs=30218 size=525.78KiB + /6/3S (2|25|36): objs=142 size=297B + /6/4N (2|25|36): objs=10802 size=61.43KiB + /6/5N (2|25|36): objs=929 size=3.67KiB + /6/6S (2|25|36): objs=150 size=325B + /6/7N (2|25|36): objs=743 size=2.63KiB + /6/8S (2|25|36): objs=172 size=155B + /6/9N (2|25|36): objs=4575 size=20.39KiB + /6/10S (2|25|36): objs=144 size=141B + /6/11N (2|25|36): objs=2657 size=11.83KiB + /6/12S (2|25|36): objs=146 size=121B + /6/13N (2|25|36): objs=4240 size=20.24KiB + /6/14S (2|25|36): objs=171 size=262B + /6/15N (2|25|36): objs=2523 size=10.85KiB + /6/16S (2|25|36): objs=166 size=334B + /6/17S (2|25|36): objs=150 size=186B + /6/18S (2|25|36): objs=161 size=114B + /6/19N (2|25|36): objs=608 size=2.21KiB + /6/20S (2|25|36): objs=140 size=137B + /6/21N (2|25|36): objs=1073 size=4.09KiB + /6/22S (2|25|36): objs=172 size=103B + /6/23N (2|25|36): objs=1943 size=7.99KiB + /6/24S (2|25|36): objs=160 size=151B + /6/25N (2|25|36): objs=2250 size=9.5KiB + /6/26S (2|25|36): objs=151 size=336B + /6/27N (2|25|36): objs=4647 size=23.19KiB + /6/28S (2|25|36): objs=150 size=264B + /6/29N (2|25|36): objs=3614 size=16.79KiB + /6/30S (2|25|36): objs=149 size=221B + /6/31N (2|25|36): objs=4221 size=18.36KiB + /6/32S (2|25|36): objs=150 size=322B + /6/33N (2|25|36): objs=1441 size=6.07KiB + /6/34S (2|25|36): objs=163 size=257B + /6/35N (2|25|36): objs=621 size=2.25KiB + /7/0N (2|25|36): objs=38622 size=853.26KiB + /7/1N (2|25|36): objs=35860 size=687.75KiB + /7/2N (2|25|36): objs=38329 size=868.69KiB + /7/3N (2|25|36): objs=13014 size=90.44KiB + /7/4S (2|25|36): objs=147 size=249B + /7/5N (2|25|36): objs=608 size=2.2KiB + /7/6S (2|25|36): objs=137 size=98B + /7/7N (2|25|36): objs=294 size=889B + /7/8S (2|25|36): objs=170 size=316B + /7/9S (2|25|36): objs=153 size=118B + /7/10S (2|25|36): objs=143 size=289B + /7/11N (2|25|36): objs=610 size=2.14KiB + /7/12S (2|25|36): objs=125 size=239B + /7/13N (2|25|36): objs=1680 size=7.04KiB + /7/14S (2|25|36): objs=185 size=333B + /7/15N (2|25|36): objs=1369 size=5.66KiB + /7/16S (2|25|36): objs=145 size=194B + /7/17N (2|25|36): objs=1227 size=4.7KiB + /7/18S (2|25|36): objs=145 size=126B + /7/19N (2|25|36): objs=4082 size=17.98KiB + /7/20S (2|25|36): objs=141 size=163B + /7/21N (2|25|36): objs=3056 size=13.5KiB + /7/22S (2|25|36): objs=144 size=254B + /7/23N (2|25|36): objs=1623 size=7.04KiB + /7/24S (2|25|36): objs=132 size=83B + /7/25N (2|25|36): objs=3423 size=14.25KiB + /7/26S (2|25|36): objs=146 size=226B + /7/27N (2|25|36): objs=2225 size=9.69KiB + /7/28S (2|25|36): objs=160 size=208B + /7/29N (2|25|36): objs=332 size=957B + /7/30S (2|25|36): objs=159 size=106B + /7/31N (2|25|36): objs=795 size=2.85KiB + /7/32S (2|25|36): objs=141 size=237B + /7/33S (2|25|36): objs=140 size=143B + /7/34S (2|25|36): objs=145 size=292B + /7/35S (2|25|36): objs=172 size=337B + /8/0N (2|25|36): objs=37558 size=789.38KiB + /8/1N (2|25|36): objs=44865 size=1.18MiB + /8/2N (2|25|36): objs=38646 size=779.18KiB + /8/3N (2|25|36): objs=4205 size=20.39KiB + /8/4S (2|25|36): objs=162 size=306B + /8/6S (2|25|36): objs=145 size=199B + /8/7N (2|25|36): objs=2651 size=11.15KiB + /8/8S (2|25|36): objs=136 size=212B + /8/10S (2|25|36): objs=154 size=219B + /8/11N (2|25|36): objs=983 size=3.83KiB + /8/12S (2|25|36): objs=160 size=172B + /8/13N (2|25|36): objs=656 size=2.43KiB + /8/14S (2|25|36): objs=142 size=185B + /8/15N (2|25|36): objs=605 size=2.18KiB + /8/16S (2|25|36): objs=151 size=141B + /8/17N (2|25|36): objs=4818 size=21.58KiB + /8/18S (2|25|36): objs=182 size=182B + /8/19N (2|25|36): objs=2081 size=9.09KiB + /8/20S (2|25|36): objs=179 size=187B + /8/21N (2|25|36): objs=2086 size=8.59KiB + /8/22S (2|25|36): objs=161 size=192B + /8/23N (2|25|36): objs=3180 size=13.5KiB + /8/24S (2|25|36): objs=172 size=250B + /8/25N (2|25|36): objs=1568 size=6.39KiB + /8/26S (2|25|36): objs=160 size=127B + /8/27N (2|25|36): objs=1283 size=5.28KiB + /8/28S (2|25|36): objs=154 size=229B + /8/29N (2|25|36): objs=3729 size=16.46KiB + /8/30S (2|25|36): objs=130 size=143B + /8/31N (2|25|36): objs=288 size=874B + /8/32S (2|25|36): objs=162 size=238B + /8/33N (2|25|36): objs=3237 size=14.05KiB + /8/34S (2|25|36): objs=174 size=223B + /8/35N (2|25|36): objs=1492 size=6.15KiB + /9/0N (2|25|36): objs=38628 size=825.58KiB + /9/1N (2|25|36): objs=39695 size=855.62KiB + /9/2N (2|25|36): objs=30708 size=560.48KiB + /9/3S (2|25|36): objs=149 size=290B + /9/4N (2|25|36): objs=431 size=1.44KiB + /9/5S (2|25|36): objs=155 size=138B + /9/6N (2|25|36): objs=3587 size=15.77KiB + /9/7S (2|25|36): objs=154 size=227B + /9/8N (2|25|36): objs=324 size=869B + /9/9S (2|25|36): objs=157 size=230B + /9/10N (2|25|36): objs=2226 size=9.34KiB + /9/11N (2|25|36): objs=6019 size=33.51KiB + /9/12S (2|25|36): objs=157 size=317B + /9/13N (2|25|36): objs=510 size=1.79KiB + /9/14S (2|25|36): objs=167 size=193B + /9/15N (2|25|36): objs=1474 size=5.93KiB + /9/16S (2|25|36): objs=165 size=235B + /9/17N (2|25|36): objs=1732 size=7.17KiB + /9/18S (2|25|36): objs=161 size=193B + /9/19N (2|25|36): objs=5963 size=26.54KiB + /9/20S (2|25|36): objs=144 size=336B + /9/21N (2|25|36): objs=1695 size=7.06KiB + /9/22S (2|25|36): objs=125 size=254B + /9/23N (2|25|36): objs=2553 size=11.42KiB + /9/24S (2|25|36): objs=152 size=159B + /9/25N (2|25|36): objs=3867 size=17.72KiB + /9/26S (2|25|36): objs=143 size=222B + /9/27N (2|25|36): objs=2134 size=8.84KiB + /9/28S (2|25|36): objs=149 size=317B + /9/29N (2|25|36): objs=5468 size=25.46KiB + /9/30S (2|25|36): objs=152 size=231B + /9/31N (2|25|36): objs=3138 size=13.33KiB + /9/32S (2|25|36): objs=160 size=230B + /9/33S (2|25|36): objs=125 size=211B + /9/34S (2|25|36): objs=154 size=179B + /9/35S (2|25|36): objs=152 size=129B + /10/0N (2|25|36): objs=37475 size=827.97KiB + /10/1N (2|25|36): objs=45338 size=1.12MiB + /10/2N (2|25|36): objs=36694 size=803.08KiB + /10/3N (2|25|36): objs=2621 size=12.04KiB + /10/4S (2|25|36): objs=169 size=247B + /10/6S (2|25|36): objs=150 size=273B + /10/7N (2|25|36): objs=2840 size=12.98KiB + /10/8S (2|25|36): objs=157 size=231B + /10/9N (2|25|36): objs=5831 size=29.74KiB + /10/10S (2|25|36): objs=136 size=115B + /10/11N (2|25|36): objs=1491 size=5.97KiB + /10/12S (2|25|36): objs=151 size=95B + /10/13N (2|25|36): objs=5642 size=27.85KiB + /10/14S (2|25|36): objs=177 size=284B + /10/15S (2|25|36): objs=170 size=234B + /10/16S (2|25|36): objs=161 size=297B + /10/17N (2|25|36): objs=2096 size=9.05KiB + /10/18S (2|25|36): objs=159 size=130B + /10/19N (2|25|36): objs=3004 size=14.79KiB + /10/20S (2|25|36): objs=156 size=191B + /10/21N (2|25|36): objs=442 size=1.56KiB + /10/22S (2|25|36): objs=129 size=231B + /10/23N (2|25|36): objs=5066 size=23.18KiB + /10/24S (2|25|36): objs=143 size=97B + /10/25S (2|25|36): objs=151 size=313B + /10/26S (2|25|36): objs=166 size=127B + /10/27N (2|25|36): objs=2382 size=9.75KiB + /10/28S (2|25|36): objs=156 size=90B + /10/29N (2|25|36): objs=2841 size=12.05KiB + /10/30S (2|25|36): objs=153 size=299B + /10/31N (2|25|36): objs=1094 size=4.44KiB + /10/32S (2|25|36): objs=148 size=259B + /10/34S (2|25|36): objs=146 size=135B + /10/35N (2|25|36): objs=1974 size=8.15KiB + /11/0N (2|25|36): objs=39180 size=881.85KiB + /11/1N (2|25|36): objs=20484 size=221.96KiB + /11/2S (2|25|36): objs=167 size=266B + /11/3N (2|25|36): objs=18363 size=127.33KiB + /11/4N (2|25|36): objs=38828 size=944.18KiB + /11/5N (2|25|36): objs=1355 size=5.53KiB + /11/6S (2|25|36): objs=133 size=182B + /11/7N (2|25|36): objs=859 size=3.49KiB + /11/8S (2|25|36): objs=157 size=349B + /11/9N (2|25|36): objs=7640 size=41.54KiB + /11/10S (2|25|36): objs=161 size=262B + /11/11N (2|25|36): objs=1999 size=8.91KiB + /11/12S (2|25|36): objs=160 size=209B + /11/13N (2|25|36): objs=2017 size=8.45KiB + /11/14S (2|25|36): objs=157 size=313B + /11/15N (2|25|36): objs=1364 size=5.59KiB + /11/16S (2|25|36): objs=152 size=329B + /11/17N (2|25|36): objs=1686 size=6.96KiB + /11/18S (2|25|36): objs=146 size=141B + /11/19N (2|25|36): objs=6622 size=31.06KiB + /11/20S (2|25|36): objs=154 size=246B + /11/21N (2|25|36): objs=2745 size=11.83KiB + /11/22S (2|25|36): objs=131 size=271B + /11/23N (2|25|36): objs=1821 size=7.5KiB + /11/24S (2|25|36): objs=139 size=183B + /11/25N (2|25|36): objs=578 size=2.21KiB + /11/26S (2|25|36): objs=141 size=91B + /11/27N (2|25|36): objs=578 size=2.19KiB + /11/28S (2|25|36): objs=140 size=194B + /11/29N (2|25|36): objs=311 size=917B + /11/30S (2|25|36): objs=168 size=133B + /11/31N (2|25|36): objs=5254 size=26.09KiB + /11/32S (2|25|36): objs=135 size=203B + /11/33N (2|25|36): objs=1077 size=4.32KiB + /11/34S (2|25|36): objs=153 size=202B + /12/0N (2|25|36): objs=37953 size=872.82KiB + /12/1N (2|25|36): objs=39161 size=912.26KiB + /12/2N (2|25|36): objs=36380 size=803.1KiB + /12/4S (2|25|36): objs=146 size=111B + /12/5N (2|25|36): objs=3346 size=14.48KiB + /12/6S (2|25|36): objs=160 size=96B + /12/7N (2|25|36): objs=1622 size=6.97KiB + /12/8S (2|25|36): objs=164 size=315B + /12/9N (2|25|36): objs=1516 size=6.12KiB + /12/10S (2|25|36): objs=146 size=220B + /12/11N (2|25|36): objs=1387 size=5.64KiB + /12/12S (2|25|36): objs=153 size=108B + /12/13N (2|25|36): objs=1036 size=3.95KiB + /12/14S (2|25|36): objs=153 size=316B + /12/15N (2|25|36): objs=1822 size=7.44KiB + /12/16S (2|25|36): objs=144 size=114B + /12/17N (2|25|36): objs=6917 size=33.29KiB + /12/18S (2|25|36): objs=174 size=146B + /12/19N (2|25|36): objs=1827 size=7.58KiB + /12/20S (2|25|36): objs=165 size=239B + /12/21N (2|25|36): objs=3389 size=14.17KiB + /12/22S (2|25|36): objs=154 size=257B + /12/23N (2|25|36): objs=3698 size=17.2KiB + /12/24S (2|25|36): objs=147 size=260B + /12/25N (2|25|36): objs=1821 size=7.94KiB + /12/26S (2|25|36): objs=167 size=285B + /12/27N (2|25|36): objs=1082 size=4.35KiB + /12/28S (2|25|36): objs=171 size=118B + /12/29N (2|25|36): objs=3791 size=16.05KiB + /12/30S (2|25|36): objs=153 size=222B + /12/32S (2|25|36): objs=168 size=323B + /12/33N (2|25|36): objs=2596 size=11.35KiB + /12/34S (2|25|36): objs=141 size=137B + /12/35N (2|25|36): objs=3385 size=15.96KiB + /13/0N (2|25|36): objs=43126 size=1018.24KiB + /13/1N (2|25|36): objs=39486 size=781.21KiB + /13/2N (2|25|36): objs=2293 size=9.56KiB + /13/3S (2|25|36): objs=162 size=258B + /13/4N (2|25|36): objs=30699 size=510.32KiB + /13/5N (2|25|36): objs=13278 size=78.51KiB + /13/6S (2|25|36): objs=187 size=372B + /13/7N (2|25|36): objs=497 size=1.53KiB + /13/8S (2|25|36): objs=140 size=150B + /13/9N (2|25|36): objs=2232 size=9.26KiB + /13/10S (2|25|36): objs=135 size=307B + /13/12S (2|25|36): objs=136 size=219B + /13/13S (2|25|36): objs=143 size=181B + /13/14S (2|25|36): objs=161 size=125B + /13/16S (2|25|36): objs=133 size=148B + /13/17N (2|25|36): objs=1208 size=4.84KiB + /13/18S (2|25|36): objs=150 size=279B + /13/19N (2|25|36): objs=492 size=1.56KiB + /13/20S (2|25|36): objs=134 size=301B + /13/21N (2|25|36): objs=4236 size=21.06KiB + /13/22S (2|25|36): objs=137 size=185B + /13/23N (2|25|36): objs=2826 size=13.35KiB + /13/24S (2|25|36): objs=155 size=312B + /13/25S (2|25|36): objs=137 size=202B + /13/26S (2|25|36): objs=149 size=323B + /13/27N (2|25|36): objs=618 size=2.27KiB + /13/28S (2|25|36): objs=154 size=304B + /13/29N (2|25|36): objs=5947 size=27.27KiB + /13/30S (2|25|36): objs=143 size=163B + /13/31N (2|25|36): objs=337 size=932B + /13/32S (2|25|36): objs=163 size=280B + /13/33N (2|25|36): objs=2932 size=14.19KiB + /13/34S (2|25|36): objs=144 size=236B + /13/35S (2|25|36): objs=163 size=219B + /14/0N (2|25|36): objs=43593 size=1.01MiB + /14/1N (2|25|36): objs=38479 size=772.79KiB + /14/2N (2|25|36): objs=20999 size=267.71KiB + /14/3S (2|25|36): objs=154 size=193B + /14/4N (2|25|36): objs=16215 size=98.98KiB + /14/5N (2|25|36): objs=11555 size=69.88KiB + /14/6S (2|25|36): objs=151 size=192B + /14/7N (2|25|36): objs=5800 size=27.11KiB + /14/8S (2|25|36): objs=158 size=183B + /14/9N (2|25|36): objs=4411 size=20.09KiB + /14/10S (2|25|36): objs=151 size=99B + /14/11N (2|25|36): objs=748 size=2.85KiB + /14/12S (2|25|36): objs=133 size=261B + /14/13S (2|25|36): objs=121 size=211B + /14/14S (2|25|36): objs=134 size=162B + /14/16S (2|25|36): objs=140 size=286B + /14/17N (2|25|36): objs=2190 size=9.25KiB + /14/18S (2|25|36): objs=147 size=336B + /14/19N (2|25|36): objs=300 size=851B + /14/20S (2|25|36): objs=145 size=109B + /14/21N (2|25|36): objs=803 size=3.29KiB + /14/22S (2|25|36): objs=176 size=287B + /14/23N (2|25|36): objs=2023 size=9.05KiB + /14/24S (2|25|36): objs=169 size=340B + /14/26S (2|25|36): objs=154 size=309B + /14/27N (2|25|36): objs=2493 size=10.5KiB + /14/28S (2|25|36): objs=137 size=329B + /14/29N (2|25|36): objs=1050 size=4.12KiB + /14/30S (2|25|36): objs=145 size=331B + /14/31N (2|25|36): objs=734 size=2.7KiB + /14/32S (2|25|36): objs=143 size=108B + /14/33N (2|25|36): objs=2689 size=11.47KiB + /14/34S (2|25|36): objs=157 size=99B + /14/35N (2|25|36): objs=271 size=914B + /15/0N (2|25|36): objs=37275 size=791.07KiB + /15/1N (2|25|36): objs=37338 size=763.68KiB + /15/2N (2|25|36): objs=36754 size=820.84KiB + /15/3S (2|25|36): objs=141 size=87B + /15/4N (2|25|36): objs=646 size=2.27KiB + /15/5S (2|25|36): objs=144 size=183B + /15/6N (2|25|36): objs=1642 size=7.13KiB + /15/8S (2|25|36): objs=176 size=115B + /15/9N (2|25|36): objs=6551 size=29.53KiB + /15/10S (2|25|36): objs=152 size=138B + /15/11N (2|25|36): objs=577 size=2.26KiB + /15/12S (2|25|36): objs=156 size=277B + /15/13N (2|25|36): objs=2445 size=10.33KiB + /15/14S (2|25|36): objs=146 size=318B + /15/15S (2|25|36): objs=157 size=224B + /15/16S (2|25|36): objs=152 size=193B + /15/17N (2|25|36): objs=3231 size=14.46KiB + /15/18S (2|25|36): objs=145 size=183B + /15/19N (2|25|36): objs=3446 size=15.95KiB + /15/20S (2|25|36): objs=151 size=274B + /15/21N (2|25|36): objs=4194 size=19.18KiB + /15/22S (2|25|36): objs=155 size=315B + /15/23N (2|25|36): objs=3834 size=17.84KiB + /15/24S (2|25|36): objs=156 size=158B + /15/25N (2|25|36): objs=2704 size=12.22KiB + /15/26S (2|25|36): objs=158 size=262B + /15/27N (2|25|36): objs=1700 size=6.8KiB + /15/28S (2|25|36): objs=162 size=128B + /15/29N (2|25|36): objs=749 size=2.77KiB + /15/30S (2|25|36): objs=163 size=133B + /15/31N (2|25|36): objs=4367 size=20.54KiB + /15/32S (2|25|36): objs=174 size=128B + /15/33N (2|25|36): objs=1669 size=7.09KiB + /15/34S (2|25|36): objs=149 size=299B + /15/35N (2|25|36): objs=1081 size=4.25KiB + /16/0N (2|25|36): objs=41967 size=926.03KiB + /16/1N (2|25|36): objs=39172 size=959.83KiB + /16/2N (2|25|36): objs=37194 size=742.05KiB + /16/3N (2|25|36): objs=3559 size=15.28KiB + /16/4S (2|25|36): objs=162 size=149B + /16/5N (2|25|36): objs=1079 size=4.07KiB + /16/6S (2|25|36): objs=160 size=122B + /16/7N (2|25|36): objs=633 size=2.36KiB + /16/8S (2|25|36): objs=153 size=263B + /16/9N (2|25|36): objs=903 size=3.42KiB + /16/10S (2|25|36): objs=149 size=204B + /16/11N (2|25|36): objs=1270 size=5.18KiB + /16/12S (2|25|36): objs=172 size=207B + /16/13N (2|25|36): objs=5613 size=26.92KiB + /16/14S (2|25|36): objs=152 size=303B + /16/15N (2|25|36): objs=5683 size=26.22KiB + /16/16S (2|25|36): objs=163 size=289B + /16/17S (2|25|36): objs=156 size=111B + /16/18S (2|25|36): objs=157 size=234B + /16/19N (2|25|36): objs=3026 size=13.05KiB + /16/20S (2|25|36): objs=162 size=226B + /16/21N (2|25|36): objs=1682 size=7.2KiB + /16/22S (2|25|36): objs=150 size=113B + /16/23N (2|25|36): objs=2254 size=9.4KiB + /16/24S (2|25|36): objs=154 size=214B + /16/25N (2|25|36): objs=810 size=3.24KiB + /16/26S (2|25|36): objs=150 size=282B + /16/27N (2|25|36): objs=637 size=2.29KiB + /16/28S (2|25|36): objs=136 size=114B + /16/29N (2|25|36): objs=1642 size=7.09KiB + /16/30S (2|25|36): objs=131 size=321B + /16/31N (2|25|36): objs=1097 size=4.38KiB + /16/32S (2|25|36): objs=167 size=279B + /16/33N (2|25|36): objs=2301 size=9.43KiB + /16/34S (2|25|36): objs=145 size=331B + /16/35N (2|25|36): objs=1228 size=5.05KiB + /17/0N (2|25|36): objs=34831 size=589.92KiB + /17/1N (2|25|36): objs=41285 size=939.79KiB + /17/2N (2|25|36): objs=38260 size=890.53KiB + /17/3N (2|25|36): objs=7078 size=33.02KiB + /17/4S (2|25|36): objs=141 size=242B + /17/5N (2|25|36): objs=4094 size=17.92KiB + /17/6S (2|25|36): objs=145 size=250B + /17/7N (2|25|36): objs=6944 size=30.96KiB + /17/8S (2|25|36): objs=141 size=318B + /17/9N (2|25|36): objs=926 size=3.87KiB + /17/10S (2|25|36): objs=143 size=85B + /17/11N (2|25|36): objs=910 size=3.47KiB + /17/12S (2|25|36): objs=164 size=219B + /17/13N (2|25|36): objs=1741 size=7.06KiB + /17/14S (2|25|36): objs=133 size=261B + /17/15N (2|25|36): objs=789 size=2.91KiB + /17/16S (2|25|36): objs=156 size=345B + /17/17N (2|25|36): objs=2772 size=11.65KiB + /17/18S (2|25|36): objs=149 size=143B + /17/19N (2|25|36): objs=1193 size=5.38KiB + /17/20S (2|25|36): objs=149 size=264B + /17/21S (2|25|36): objs=163 size=280B + /17/22S (2|25|36): objs=152 size=200B + /17/23N (2|25|36): objs=1852 size=7.66KiB + /17/24S (2|25|36): objs=145 size=247B + /17/25N (2|25|36): objs=2100 size=9.18KiB + /17/26S (2|25|36): objs=149 size=129B + /17/27N (2|25|36): objs=1341 size=5.71KiB + /17/28S (2|25|36): objs=150 size=343B + /17/29N (2|25|36): objs=644 size=2.41KiB + /17/30S (2|25|36): objs=154 size=330B + /17/31N (2|25|36): objs=737 size=3.02KiB + /17/32S (2|25|36): objs=165 size=126B + /17/33N (2|25|36): objs=2312 size=9.97KiB + /17/34S (2|25|36): objs=137 size=296B + /17/35N (2|25|36): objs=1438 size=6.59KiB + /18/0N (2|25|36): objs=41786 size=1.06MiB + /18/1N (2|25|36): objs=43505 size=1.1MiB + /18/2N (2|25|36): objs=35952 size=745.62KiB + /18/3N (2|25|36): objs=11438 size=63.9KiB + /18/4S (2|25|36): objs=148 size=240B + /18/5N (2|25|36): objs=1654 size=6.66KiB + /18/6S (2|25|36): objs=154 size=216B + /18/7N (2|25|36): objs=590 size=2.12KiB + /18/8S (2|25|36): objs=150 size=176B + /18/9N (2|25|36): objs=1500 size=6.23KiB + /18/10S (2|25|36): objs=169 size=315B + /18/12S (2|25|36): objs=149 size=275B + /18/13N (2|25|36): objs=5332 size=24.19KiB + /18/14S (2|25|36): objs=145 size=112B + /18/16S (2|25|36): objs=154 size=125B + /18/17N (2|25|36): objs=957 size=3.99KiB + /18/18S (2|25|36): objs=141 size=164B + /18/19N (2|25|36): objs=1647 size=7.08KiB + /18/20S (2|25|36): objs=161 size=224B + /18/21N (2|25|36): objs=445 size=1.56KiB + /18/22S (2|25|36): objs=147 size=234B + /18/23N (2|25|36): objs=1167 size=5.03KiB + /18/24S (2|25|36): objs=159 size=198B + /18/25N (2|25|36): objs=2462 size=10.45KiB + /18/26S (2|25|36): objs=133 size=83B + /18/27N (2|25|36): objs=473 size=1.56KiB + /18/28S (2|25|36): objs=164 size=190B + /18/29N (2|25|36): objs=718 size=2.63KiB + /18/30S (2|25|36): objs=165 size=294B + /18/31N (2|25|36): objs=865 size=3.13KiB + /18/32S (2|25|36): objs=176 size=177B + /18/33N (2|25|36): objs=3021 size=13.48KiB + /18/34S (2|25|36): objs=136 size=323B + /18/35N (2|25|36): objs=925 size=3.53KiB + /19/0N (2|25|36): objs=42250 size=1.04MiB + /19/1N (2|25|36): objs=39467 size=870.94KiB + /19/2N (2|25|36): objs=35514 size=663.13KiB + /19/3S (2|25|36): objs=161 size=164B + /19/4N (2|25|36): objs=310 size=819B + /19/5S (2|25|36): objs=151 size=132B + /19/6N (2|25|36): objs=3332 size=15.3KiB + /19/7N (2|25|36): objs=2141 size=8.79KiB + /19/8S (2|25|36): objs=150 size=157B + /19/9N (2|25|36): objs=783 size=3.03KiB + /19/10S (2|25|36): objs=143 size=215B + /19/12S (2|25|36): objs=166 size=255B + /19/13S (2|25|36): objs=166 size=203B + /19/14S (2|25|36): objs=136 size=84B + /19/15N (2|25|36): objs=470 size=1.47KiB + /19/16S (2|25|36): objs=154 size=335B + /19/17N (2|25|36): objs=1049 size=4.14KiB + /19/18S (2|25|36): objs=189 size=95B + /19/19N (2|25|36): objs=896 size=3.38KiB + /19/20S (2|25|36): objs=139 size=206B + /19/21N (2|25|36): objs=5457 size=28.96KiB + /19/22S (2|25|36): objs=128 size=181B + /19/23N (2|25|36): objs=762 size=2.99KiB + /19/24S (2|25|36): objs=146 size=150B + /19/25N (2|25|36): objs=2253 size=9.5KiB + /19/26S (2|25|36): objs=152 size=126B + /19/27N (2|25|36): objs=1752 size=7.34KiB + /19/28S (2|25|36): objs=146 size=230B + /19/29N (2|25|36): objs=4353 size=20.54KiB + /19/30S (2|25|36): objs=166 size=338B + /19/31N (2|25|36): objs=1712 size=6.74KiB + /19/32S (2|25|36): objs=171 size=91B + /19/33N (2|25|36): objs=6972 size=32.25KiB + /19/34S (2|25|36): objs=166 size=205B + /19/35N (2|25|36): objs=6243 size=29.58KiB + /20/0N (2|25|36): objs=39254 size=862.54KiB + /20/1N (2|25|36): objs=39619 size=832.93KiB + /20/2N (2|25|36): objs=40921 size=992.1KiB + /20/3S (2|25|36): objs=154 size=337B + /20/4N (2|25|36): objs=2345 size=10.69KiB + /20/5N (2|25|36): objs=1224 size=4.82KiB + /20/6S (2|25|36): objs=138 size=94B + /20/7N (2|25|36): objs=302 size=985B + /20/8S (2|25|36): objs=156 size=322B + /20/9N (2|25|36): objs=4661 size=21.56KiB + /20/10S (2|25|36): objs=145 size=228B + /20/11N (2|25|36): objs=1084 size=4.36KiB + /20/12S (2|25|36): objs=159 size=290B + /20/14S (2|25|36): objs=155 size=108B + /20/15N (2|25|36): objs=3438 size=14.79KiB + /20/16S (2|25|36): objs=153 size=330B + /20/17N (2|25|36): objs=2433 size=10.47KiB + /20/18S (2|25|36): objs=171 size=118B + /20/19N (2|25|36): objs=5586 size=25.24KiB + /20/20S (2|25|36): objs=165 size=345B + /20/21N (2|25|36): objs=1063 size=4.31KiB + /20/22S (2|25|36): objs=140 size=105B + /20/23N (2|25|36): objs=6876 size=43.08KiB + /20/24S (2|25|36): objs=142 size=102B + /20/25N (2|25|36): objs=1979 size=8.25KiB + /20/26S (2|25|36): objs=136 size=302B + /20/27N (2|25|36): objs=1964 size=8.2KiB + /20/28S (2|25|36): objs=153 size=141B + /20/29N (2|25|36): objs=2483 size=10.62KiB + /20/30S (2|25|36): objs=149 size=307B + /20/31N (2|25|36): objs=3035 size=12.97KiB + /20/32S (2|25|36): objs=136 size=279B + /20/33N (2|25|36): objs=624 size=2.28KiB + /20/34S (2|25|36): objs=151 size=326B + /20/35N (2|25|36): objs=911 size=3.81KiB + /21/0N (2|25|36): objs=42699 size=958.25KiB + /21/1N (2|25|36): objs=38789 size=959.01KiB + /21/2N (2|25|36): objs=40113 size=934.13KiB + /21/3N (2|25|36): objs=2905 size=13.8KiB + /21/4S (2|25|36): objs=149 size=94B + /21/5N (2|25|36): objs=7156 size=34.92KiB + /21/6S (2|25|36): objs=143 size=110B + /21/7N (2|25|36): objs=813 size=2.97KiB + /21/8S (2|25|36): objs=137 size=177B + /21/9N (2|25|36): objs=3335 size=15.96KiB + /21/10S (2|25|36): objs=124 size=296B + /21/11N (2|25|36): objs=462 size=1.6KiB + /21/12S (2|25|36): objs=155 size=249B + /21/13N (2|25|36): objs=2434 size=12.03KiB + /21/14S (2|25|36): objs=144 size=181B + /21/15N (2|25|36): objs=1683 size=6.97KiB + /21/16S (2|25|36): objs=151 size=84B + /21/17N (2|25|36): objs=1193 size=4.82KiB + /21/18S (2|25|36): objs=155 size=155B + /21/19N (2|25|36): objs=443 size=1.56KiB + /21/20S (2|25|36): objs=140 size=299B + /21/21N (2|25|36): objs=1680 size=7KiB + /21/22S (2|25|36): objs=177 size=211B + /21/23N (2|25|36): objs=490 size=1.81KiB + /21/24S (2|25|36): objs=157 size=329B + /21/25N (2|25|36): objs=1467 size=6.03KiB + /21/26S (2|25|36): objs=148 size=204B + /21/27N (2|25|36): objs=2615 size=11.28KiB + /21/28S (2|25|36): objs=160 size=193B + /21/29N (2|25|36): objs=2184 size=9.05KiB + /21/30S (2|25|36): objs=153 size=190B + /21/31N (2|25|36): objs=6835 size=34.34KiB + /21/32S (2|25|36): objs=147 size=244B + /21/33S (2|25|36): objs=158 size=232B + /21/34S (2|25|36): objs=165 size=220B + /21/35N (2|25|36): objs=2956 size=12.54KiB + /22/0N (2|25|36): objs=13765 size=99.42KiB + /22/1S (2|25|36): objs=170 size=226B + /22/2N (2|25|36): objs=27185 size=319.56KiB + /22/3N (2|25|36): objs=41161 size=969.38KiB + /22/4N (2|25|36): objs=42896 size=1.02MiB + /22/5N (2|25|36): objs=5022 size=24.41KiB + /22/6S (2|25|36): objs=169 size=351B + /22/8S (2|25|36): objs=150 size=329B + /22/9N (2|25|36): objs=4477 size=22.14KiB + /22/10S (2|25|36): objs=164 size=205B + /22/11N (2|25|36): objs=296 size=712B + /22/12S (2|25|36): objs=156 size=167B + /22/13N (2|25|36): objs=2443 size=10.35KiB + /22/14S (2|25|36): objs=158 size=280B + /22/15N (2|25|36): objs=4538 size=21.39KiB + /22/16S (2|25|36): objs=152 size=262B + /22/17N (2|25|36): objs=2534 size=11.02KiB + /22/18S (2|25|36): objs=127 size=106B + /22/20S (2|25|36): objs=146 size=212B + /22/21N (2|25|36): objs=4835 size=21.62KiB + /22/22S (2|25|36): objs=153 size=234B + /22/23N (2|25|36): objs=1590 size=6.42KiB + /22/24S (2|25|36): objs=138 size=127B + /22/25N (2|25|36): objs=1050 size=4.13KiB + /22/26S (2|25|36): objs=161 size=350B + /22/27N (2|25|36): objs=310 size=983B + /22/28S (2|25|36): objs=143 size=242B + /22/29N (2|25|36): objs=335 size=1.01KiB + /22/30S (2|25|36): objs=154 size=292B + /22/31N (2|25|36): objs=2015 size=8.28KiB + /22/32S (2|25|36): objs=154 size=95B + /22/33N (2|25|36): objs=3015 size=12.83KiB + /22/34S (2|25|36): objs=191 size=329B + /22/35N (2|25|36): objs=792 size=3.03KiB + /23/0N (2|25|36): objs=44679 size=1.01MiB + /23/1N (2|25|36): objs=38360 size=829.34KiB + /23/2N (2|25|36): objs=37072 size=627.77KiB + /23/3N (2|25|36): objs=5188 size=25.34KiB + /23/4S (2|25|36): objs=159 size=222B + /23/5N (2|25|36): objs=321 size=923B + /23/6S (2|25|36): objs=141 size=98B + /23/7S (2|25|36): objs=145 size=248B + /23/8S (2|25|36): objs=178 size=116B + /23/9N (2|25|36): objs=2898 size=12.17KiB + /23/10S (2|25|36): objs=148 size=102B + /23/11N (2|25|36): objs=1075 size=4.23KiB + /23/12S (2|25|36): objs=152 size=234B + /23/13N (2|25|36): objs=3287 size=14.76KiB + /23/14S (2|25|36): objs=143 size=95B + /23/15N (2|25|36): objs=1809 size=7.35KiB + /23/16S (2|25|36): objs=161 size=320B + /23/17N (2|25|36): objs=283 size=763B + /23/18S (2|25|36): objs=149 size=338B + /23/20S (2|25|36): objs=165 size=147B + /23/21N (2|25|36): objs=3822 size=16.17KiB + /23/22S (2|25|36): objs=170 size=96B + /23/23N (2|25|36): objs=473 size=1.63KiB + /23/24S (2|25|36): objs=134 size=143B + /23/25N (2|25|36): objs=1139 size=4.52KiB + /23/26S (2|25|36): objs=148 size=274B + /23/28S (2|25|36): objs=145 size=179B + /23/29N (2|25|36): objs=5034 size=21.51KiB + /23/30S (2|25|36): objs=147 size=133B + /23/31N (2|25|36): objs=4865 size=21.98KiB + /23/32S (2|25|36): objs=178 size=188B + /23/33N (2|25|36): objs=3878 size=19.48KiB + /23/34S (2|25|36): objs=146 size=247B + /23/35N (2|25|36): objs=291 size=778B + /24/0N (2|25|36): objs=37549 size=788.15KiB + /24/1N (2|25|36): objs=38051 size=806.01KiB + /24/2N (2|25|36): objs=33411 size=700.86KiB + /24/3S (2|25|36): objs=149 size=253B + /24/4N (2|25|36): objs=7529 size=36.77KiB + /24/5N (2|25|36): objs=8122 size=42.19KiB + /24/6S (2|25|36): objs=147 size=277B + /24/7S (2|25|36): objs=156 size=143B + /24/8S (2|25|36): objs=156 size=129B + /24/9N (2|25|36): objs=1675 size=7.07KiB + /24/10S (2|25|36): objs=148 size=231B + /24/12S (2|25|36): objs=156 size=342B + /24/13N (2|25|36): objs=588 size=2.06KiB + /24/14S (2|25|36): objs=162 size=135B + /24/15N (2|25|36): objs=7197 size=33.51KiB + /24/16S (2|25|36): objs=163 size=255B + /24/17N (2|25|36): objs=920 size=3.76KiB + /24/18S (2|25|36): objs=166 size=141B + /24/19S (2|25|36): objs=151 size=322B + /24/20S (2|25|36): objs=159 size=225B + /24/21N (2|25|36): objs=3406 size=15.42KiB + /24/22S (2|25|36): objs=159 size=196B + /24/23N (2|25|36): objs=4373 size=18.92KiB + /24/24S (2|25|36): objs=163 size=98B + /24/25N (2|25|36): objs=1657 size=6.98KiB + /24/26S (2|25|36): objs=164 size=219B + /24/27N (2|25|36): objs=1075 size=4.32KiB + /24/28S (2|25|36): objs=149 size=108B + /24/29N (2|25|36): objs=2514 size=10.73KiB + /24/30S (2|25|36): objs=158 size=177B + /24/32S (2|25|36): objs=156 size=128B + /24/33N (2|25|36): objs=781 size=2.72KiB + /24/34S (2|25|36): objs=150 size=264B + /24/35N (2|25|36): objs=1467 size=6.11KiB + /25/0N (2|25|36): objs=37303 size=769.94KiB + /25/1N (2|25|36): objs=41345 size=996.06KiB + /25/2N (2|25|36): objs=38531 size=780.92KiB + /25/3N (2|25|36): objs=15971 size=112.22KiB + /25/4S (2|25|36): objs=146 size=320B + /25/5N (2|25|36): objs=1336 size=5.56KiB + /25/6S (2|25|36): objs=155 size=93B + /25/7N (2|25|36): objs=294 size=910B + /25/8S (2|25|36): objs=167 size=107B + /25/9N (2|25|36): objs=780 size=2.92KiB + /25/10S (2|25|36): objs=138 size=278B + /25/12S (2|25|36): objs=166 size=265B + /25/13N (2|25|36): objs=4530 size=20.25KiB + /25/14S (2|25|36): objs=151 size=125B + /25/15N (2|25|36): objs=2574 size=10.77KiB + /25/16S (2|25|36): objs=161 size=211B + /25/17N (2|25|36): objs=1652 size=6.67KiB + /25/18S (2|25|36): objs=140 size=278B + /25/19N (2|25|36): objs=310 size=1.04KiB + /25/20S (2|25|36): objs=140 size=330B + /25/21N (2|25|36): objs=1614 size=6.84KiB + /25/22S (2|25|36): objs=154 size=132B + /25/23N (2|25|36): objs=593 size=2.21KiB + /25/24S (2|25|36): objs=147 size=154B + /25/25N (2|25|36): objs=1090 size=4.06KiB + /25/26S (2|25|36): objs=168 size=294B + /25/27N (2|25|36): objs=2275 size=9.66KiB + /25/28S (2|25|36): objs=167 size=91B + /25/29S (2|25|36): objs=153 size=201B + /25/30S (2|25|36): objs=146 size=316B + /25/32S (2|25|36): objs=134 size=258B + /25/33N (2|25|36): objs=3336 size=15.42KiB + /25/34S (2|25|36): objs=152 size=179B + /25/35N (2|25|36): objs=750 size=2.72KiB + /26/0N (2|25|36): objs=37022 size=761.43KiB + /26/1N (2|25|36): objs=42236 size=1.03MiB + /26/2N (2|25|36): objs=40201 size=848.04KiB + /26/3S (2|25|36): objs=156 size=193B + /26/4N (2|25|36): objs=470 size=1.64KiB + /26/5N (2|25|36): objs=944 size=3.6KiB + /26/6S (2|25|36): objs=131 size=183B + /26/7N (2|25|36): objs=4539 size=20.18KiB + /26/8S (2|25|36): objs=138 size=309B + /26/9N (2|25|36): objs=2032 size=8.29KiB + /26/10S (2|25|36): objs=166 size=269B + /26/11N (2|25|36): objs=1487 size=6.31KiB + /26/12S (2|25|36): objs=135 size=231B + /26/13N (2|25|36): objs=1889 size=7.89KiB + /26/14S (2|25|36): objs=153 size=199B + /26/15N (2|25|36): objs=3804 size=16.8KiB + /26/16S (2|25|36): objs=156 size=165B + /26/17N (2|25|36): objs=3329 size=14.34KiB + /26/18S (2|25|36): objs=159 size=217B + /26/19N (2|25|36): objs=856 size=3.38KiB + /26/20S (2|25|36): objs=156 size=264B + /26/21N (2|25|36): objs=1063 size=4.04KiB + /26/22S (2|25|36): objs=129 size=100B + /26/23N (2|25|36): objs=1051 size=4.21KiB + /26/24S (2|25|36): objs=146 size=263B + /26/25N (2|25|36): objs=1219 size=4.81KiB + /26/26S (2|25|36): objs=167 size=306B + /26/27N (2|25|36): objs=8919 size=46.1KiB + /26/28S (2|25|36): objs=186 size=296B + /26/29N (2|25|36): objs=1391 size=5.67KiB + /26/30S (2|25|36): objs=133 size=270B + /26/31N (2|25|36): objs=745 size=2.88KiB + /26/32S (2|25|36): objs=142 size=231B + /26/33N (2|25|36): objs=3990 size=18.42KiB + /26/34S (2|25|36): objs=163 size=327B + /26/35N (2|25|36): objs=607 size=2.23KiB + /27/0N (2|25|36): objs=39530 size=1.01MiB + /27/1N (2|25|36): objs=35263 size=741.62KiB + /27/2N (2|25|36): objs=33664 size=627.94KiB + /27/3S (2|25|36): objs=159 size=126B + /27/4N (2|25|36): objs=472 size=1.76KiB + /27/5S (2|25|36): objs=133 size=216B + /27/6N (2|25|36): objs=3630 size=16.79KiB + /27/7N (2|25|36): objs=3405 size=15.22KiB + /27/8S (2|25|36): objs=172 size=345B + /27/9N (2|25|36): objs=1876 size=7.8KiB + /27/10S (2|25|36): objs=155 size=337B + /27/11N (2|25|36): objs=2690 size=11.98KiB + /27/12S (2|25|36): objs=171 size=110B + /27/13N (2|25|36): objs=2010 size=8.5KiB + /27/14S (2|25|36): objs=124 size=117B + /27/15N (2|25|36): objs=6253 size=29.07KiB + /27/16S (2|25|36): objs=154 size=269B + /27/17N (2|25|36): objs=578 size=2.08KiB + /27/18S (2|25|36): objs=155 size=197B + /27/19N (2|25|36): objs=1494 size=6.25KiB + /27/20S (2|25|36): objs=154 size=92B + /27/21N (2|25|36): objs=5643 size=28.51KiB + /27/22S (2|25|36): objs=144 size=298B + /27/23N (2|25|36): objs=2732 size=11.69KiB + /27/24S (2|25|36): objs=154 size=317B + /27/25N (2|25|36): objs=1142 size=4.64KiB + /27/26S (2|25|36): objs=154 size=202B + /27/27N (2|25|36): objs=1821 size=7.45KiB + /27/28S (2|25|36): objs=158 size=218B + /27/29N (2|25|36): objs=477 size=1.53KiB + /27/30S (2|25|36): objs=161 size=90B + /27/31N (2|25|36): objs=2446 size=10.46KiB + /27/32S (2|25|36): objs=147 size=94B + /27/33N (2|25|36): objs=1112 size=4.53KiB + /27/34S (2|25|36): objs=150 size=338B + /27/35N (2|25|36): objs=4627 size=21.06KiB + /28/0N (2|25|36): objs=38823 size=824.06KiB + /28/1N (2|25|36): objs=41143 size=982.32KiB + /28/2N (2|25|36): objs=35925 size=737.78KiB + /28/3N (2|25|36): objs=16377 size=111.98KiB + /28/4S (2|25|36): objs=153 size=334B + /28/5S (2|25|36): objs=145 size=99B + /28/6S (2|25|36): objs=156 size=320B + /28/7N (2|25|36): objs=1430 size=5.47KiB + /28/8S (2|25|36): objs=162 size=237B + /28/9N (2|25|36): objs=622 size=2.23KiB + /28/10S (2|25|36): objs=135 size=138B + /28/11N (2|25|36): objs=1226 size=5.06KiB + /28/12S (2|25|36): objs=149 size=339B + /28/13N (2|25|36): objs=1428 size=5.83KiB + /28/14S (2|25|36): objs=176 size=355B + /28/15N (2|25|36): objs=1448 size=6.05KiB + /28/16S (2|25|36): objs=138 size=300B + /28/17N (2|25|36): objs=603 size=2.25KiB + /28/18S (2|25|36): objs=138 size=158B + /28/19N (2|25|36): objs=574 size=1.97KiB + /28/20S (2|25|36): objs=151 size=94B + /28/21N (2|25|36): objs=906 size=3.54KiB + /28/22S (2|25|36): objs=176 size=240B + /28/23N (2|25|36): objs=579 size=2KiB + /28/24S (2|25|36): objs=158 size=209B + /28/25N (2|25|36): objs=3320 size=14.73KiB + /28/26S (2|25|36): objs=141 size=125B + /28/27N (2|25|36): objs=1388 size=5.76KiB + /28/28S (2|25|36): objs=165 size=100B + /28/29N (2|25|36): objs=4364 size=19.38KiB + /28/30S (2|25|36): objs=164 size=128B + /28/31N (2|25|36): objs=1444 size=5.98KiB + /28/32S (2|25|36): objs=173 size=137B + /28/33N (2|25|36): objs=2485 size=11.36KiB + /28/34S (2|25|36): objs=156 size=121B + /28/35N (2|25|36): objs=464 size=1.44KiB + /29/0N (2|25|36): objs=42051 size=1.08MiB + /29/1N (2|25|36): objs=34950 size=653.31KiB + /29/2N (2|25|36): objs=39213 size=850.74KiB + /29/3N (2|25|36): objs=6378 size=31.97KiB + /29/4S (2|25|36): objs=167 size=234B + /29/5S (2|25|36): objs=182 size=202B + /29/6S (2|25|36): objs=144 size=116B + /29/7N (2|25|36): objs=3086 size=14.28KiB + /29/8S (2|25|36): objs=148 size=286B + /29/9N (2|25|36): objs=3061 size=12.84KiB + /29/10S (2|25|36): objs=142 size=122B + /29/11N (2|25|36): objs=6755 size=30.57KiB + /29/12S (2|25|36): objs=163 size=182B + /29/13N (2|25|36): objs=1939 size=8.01KiB + /29/14S (2|25|36): objs=165 size=330B + /29/15N (2|25|36): objs=937 size=3.73KiB + /29/16S (2|25|36): objs=155 size=312B + /29/17N (2|25|36): objs=1844 size=7.61KiB + /29/18S (2|25|36): objs=147 size=233B + /29/20S (2|25|36): objs=142 size=151B + /29/22S (2|25|36): objs=151 size=220B + /29/23N (2|25|36): objs=1483 size=6.47KiB + /29/24S (2|25|36): objs=168 size=190B + /29/25N (2|25|36): objs=1212 size=4.62KiB + /29/26S (2|25|36): objs=154 size=277B + /29/27N (2|25|36): objs=4717 size=20.66KiB + /29/28S (2|25|36): objs=166 size=159B + /29/29S (2|25|36): objs=150 size=258B + /29/30S (2|25|36): objs=148 size=285B + /29/31N (2|25|36): objs=773 size=2.85KiB + /29/32S (2|25|36): objs=133 size=262B + /29/33N (2|25|36): objs=1550 size=6.6KiB + /29/34S (2|25|36): objs=142 size=316B + /30/0N (2|25|36): objs=40324 size=934.07KiB + /30/1N (2|25|36): objs=41033 size=932.5KiB + /30/2N (2|25|36): objs=27568 size=331.68KiB + /30/3S (2|25|36): objs=161 size=106B + /30/4N (2|25|36): objs=12255 size=73.49KiB + /30/5N (2|25|36): objs=3332 size=15.05KiB + /30/6S (2|25|36): objs=152 size=109B + /30/7N (2|25|36): objs=8011 size=37.58KiB + /30/8S (2|25|36): objs=158 size=141B + /30/9N (2|25|36): objs=639 size=2.44KiB + /30/10S (2|25|36): objs=145 size=222B + /30/11N (2|25|36): objs=578 size=2.23KiB + /30/12S (2|25|36): objs=154 size=237B + /30/13N (2|25|36): objs=6012 size=30.48KiB + /30/14S (2|25|36): objs=124 size=181B + /30/15N (2|25|36): objs=755 size=2.83KiB + /30/16S (2|25|36): objs=154 size=229B + /30/18S (2|25|36): objs=152 size=135B + /30/19N (2|25|36): objs=7213 size=34.73KiB + /30/20S (2|25|36): objs=144 size=266B + /30/21N (2|25|36): objs=456 size=1.44KiB + /30/22S (2|25|36): objs=173 size=93B + /30/23N (2|25|36): objs=1013 size=4.11KiB + /30/24S (2|25|36): objs=160 size=177B + /30/25N (2|25|36): objs=3326 size=15.12KiB + /30/26S (2|25|36): objs=168 size=237B + /30/27N (2|25|36): objs=284 size=792B + /30/28S (2|25|36): objs=150 size=286B + /30/29N (2|25|36): objs=1034 size=4.12KiB + /30/30S (2|25|36): objs=169 size=99B + /30/31N (2|25|36): objs=1619 size=6.79KiB + /30/32S (2|25|36): objs=147 size=195B + /30/33S (2|25|36): objs=148 size=226B + /30/34S (2|25|36): objs=148 size=136B + /30/35N (2|25|36): objs=3902 size=16.97KiB + /31/0N (2|25|36): objs=37858 size=728.3KiB + /31/1N (2|25|36): objs=40873 size=808.11KiB + /31/2N (2|25|36): objs=39136 size=942.81KiB + /31/3N (2|25|36): objs=3852 size=17.29KiB + /31/4S (2|25|36): objs=171 size=172B + /31/5N (2|25|36): objs=3686 size=16.11KiB + /31/6S (2|25|36): objs=150 size=190B + /31/7N (2|25|36): objs=626 size=2.25KiB + /31/8S (2|25|36): objs=156 size=179B + /31/9S (2|25|36): objs=175 size=285B + /31/10S (2|25|36): objs=154 size=316B + /31/11N (2|25|36): objs=1347 size=5.46KiB + /31/12S (2|25|36): objs=137 size=285B + /31/13N (2|25|36): objs=2873 size=12.45KiB + /31/14S (2|25|36): objs=158 size=228B + /31/16S (2|25|36): objs=156 size=237B + /31/17N (2|25|36): objs=970 size=3.82KiB + /31/18S (2|25|36): objs=156 size=293B + /31/19N (2|25|36): objs=2464 size=10.39KiB + /31/20S (2|25|36): objs=144 size=242B + /31/21N (2|25|36): objs=1690 size=7.04KiB + /31/22S (2|25|36): objs=161 size=173B + /31/23N (2|25|36): objs=5969 size=30.08KiB + /31/24S (2|25|36): objs=130 size=319B + /31/25N (2|25|36): objs=2580 size=10.68KiB + /31/26S (2|25|36): objs=150 size=249B + /31/27N (2|25|36): objs=293 size=891B + /31/28S (2|25|36): objs=144 size=164B + /31/29N (2|25|36): objs=864 size=3.39KiB + /31/30S (2|25|36): objs=144 size=112B + /31/31N (2|25|36): objs=5713 size=28.28KiB + /31/32S (2|25|36): objs=159 size=336B + /31/33N (2|25|36): objs=1406 size=5.93KiB + /31/34S (2|25|36): objs=167 size=240B + /31/35N (2|25|36): objs=3754 size=17.78KiB - I. Stats 1: - Wall clock time: 35.78ms - Total CPU time: 52.2ms - Serialization time: 15.91ms (30.47%) - Checksum calculation time: 3.48ms (6.66%) - Compression time: 32.71ms (62.65%) - Total IO delay: 2.76ms - Input size: 3.91MiB - Decompressed size: 18.44MiB (compression = 21.2%) - IO speed: 1.91GiB/s - Concurrency adjusted uncompressed speed: 1.38GiB/s - Actual uncompressed speed: 526.77MiB/s - Actual speed: 111.68MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 451B - Blocks: 20 (~200.13KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 +com.milaboratory.util.sorting.HashSorterTest > test2 SKIPPED - I. Stats 2: - Wall clock time: 77.54ms - Total CPU time: 104.22ms - Serialization time: 31.65ms (30.37%) - Checksum calculation time: 6.99ms (6.71%) - Compression time: 65.34ms (62.7%) - Total IO delay: 5.21ms - Input size: 7.82MiB - Decompressed size: 36.87MiB (compression = 21.2%) - IO speed: 1.53GiB/s - Concurrency adjusted uncompressed speed: 1.33GiB/s - Actual uncompressed speed: 478.88MiB/s - Actual speed: 101.53MiB/s - Objects: 18158 - Average object size uncompressed: 2.08KiB - Average object size compressed: 451B - Blocks: 40 (~200.13KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Pending / IO / Serde: 0 / 0 / 1 +com.milaboratory.util.sorting.SortingUtilTest > test1 STANDARD_OUT + Collation: 187.47ms + Sorting: 73.25ms + 1 + 217 + 41430 + 99508 + 99997 - ================== - High compression: true - Concurrency: 1 - File size: 4156299 - Write time: 2.73s +com.milaboratory.util.AtomicEnumHistogramTest > test1 STANDARD_OUT + {"labels":["A","B","C","null"],"hist":[1,2,0,1]} - O. Stats: - Wall clock time: 2.73s - Total CPU time: 2.72s - User wait time: 2.72s - Serialization time: 23.54ms (0.87%) - Checksum calculation time: 3.51ms (0.13%) - Compression time: 2.69s (98.87%) - Total IO delay: 7.8ms - Concurrency overhead: 1.2ms - Uncompressed size: 18.44MiB (~2.08KiB per object) - Output size: 3.96MiB (~457B per object; compression = 21.5%) - IO speed: 566.25MiB/s - Concurrency adjusted uncompressed speed: 6.77MiB/s - Actual uncompressed speed: 6.75MiB/s - Actual speed: 1.45MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 457B - Blocks: 62 (~65.47KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Checksum ok! +com.milaboratory.util.VersionInfoTest > test3 SKIPPED - I. Stats 1: - Wall clock time: 35.67ms - Total CPU time: 54.54ms - Serialization time: 17.53ms (32.14%) - Checksum calculation time: 3.56ms (6.52%) - Compression time: 33.06ms (60.61%) - Total IO delay: 4.6ms - Input size: 3.96MiB - Decompressed size: 18.44MiB (compression = 21.5%) - IO speed: 990.94MiB/s - Concurrency adjusted uncompressed speed: 312.49MiB/s - Actual uncompressed speed: 526.77MiB/s - Actual speed: 113.25MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 457B - Blocks: 62 (~65.47KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 +com.milaboratory.util.ByteStringTest > testSpeed1 STANDARD_OUT + Time per hash: 248ns + Addition to hash set (per operation): 653ns + Hash set removal (per operation): 411ns + a - I. Stats 2: - Wall clock time: 70.28ms - Total CPU time: 109.17ms - Serialization time: 34.9ms (31.97%) - Checksum calculation time: 7.09ms (6.5%) - Compression time: 66.1ms (60.55%) - Total IO delay: 7.8ms - Input size: 7.93MiB - Decompressed size: 36.87MiB (compression = 21.5%) - IO speed: 1.11GiB/s - Concurrency adjusted uncompressed speed: 317.88MiB/s - Actual uncompressed speed: 526.77MiB/s - Actual speed: 113.25MiB/s - Objects: 18158 - Average object size uncompressed: 2.08KiB - Average object size compressed: 457B - Blocks: 124 (~65.47KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Pending / IO / Serde: 0 / 0 / 1 +com.milaboratory.util.CacheTest > test1 STANDARD_OUT + Cache misses:400 + Cache hits:800 - ================== - High compression: true - Concurrency: 1 - File size: 4098671 - Write time: 3.01s +com.milaboratory.util.IntCombinationsTest > test1 STANDARD_OUT + [0, 1] + [0, 2] + [1, 2] - O. Stats: - Wall clock time: 3.01s - Total CPU time: 3s - User wait time: 3s - Serialization time: 25.15ms (0.84%) - Checksum calculation time: 3.58ms (0.12%) - Compression time: 2.96s (98.95%) - Total IO delay: 5.69ms - Concurrency overhead: 386.37us - Uncompressed size: 18.44MiB (~2.08KiB per object) - Output size: 3.91MiB (~451B per object; compression = 21.2%) - IO speed: 781.76MiB/s - Concurrency adjusted uncompressed speed: 6.14MiB/s - Actual uncompressed speed: 6.13MiB/s - Actual speed: 1.3MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 451B - Blocks: 20 (~200.13KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 - Checksum ok! +com.milaboratory.util.RemoveActionTest > test1 STANDARD_OUT + /tmp/milib_181f58f8949f2767e10c8950ccc4cae29426ee907752743502016606765 - I. Stats 1: - Wall clock time: 36.09ms - Total CPU time: 52.56ms - Serialization time: 16.08ms (30.6%) - Checksum calculation time: 3.56ms (6.77%) - Compression time: 32.76ms (62.32%) - Total IO delay: 2.7ms - Input size: 3.91MiB - Decompressed size: 18.44MiB (compression = 21.2%) - IO speed: 1.91GiB/s - Concurrency adjusted uncompressed speed: 335.22MiB/s - Actual uncompressed speed: 512.14MiB/s - Actual speed: 108.58MiB/s - Objects: 9079 - Average object size uncompressed: 2.08KiB - Average object size compressed: 451B - Blocks: 20 (~200.13KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 +com.milaboratory.util.RemoveActionTest > test2 STANDARD_OUT + /tmp/milib_c3de750c0f1d046df24ea5b58ea0cc682e71ef2b13770216141367585591.tmp - I. Stats 2: - Wall clock time: 78.19ms - Total CPU time: 105.58ms - Serialization time: 32.63ms (30.91%) - Checksum calculation time: 7.02ms (6.65%) - Compression time: 65.63ms (62.17%) - Total IO delay: 5.11ms - Input size: 7.82MiB - Decompressed size: 36.87MiB (compression = 21.2%) - IO speed: 1.53GiB/s - Concurrency adjusted uncompressed speed: 335.22MiB/s - Actual uncompressed speed: 472.74MiB/s - Actual speed: 100.23MiB/s - Objects: 18158 - Average object size uncompressed: 2.08KiB - Average object size compressed: 451B - Blocks: 40 (~200.13KiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 +com.milaboratory.util.NSequenceWithQualityPrintHelperTest > test1 SKIPPED -com.milaboratory.primitivio.blocks.PrimitivOBlocksTest > bigBlocks STANDARD_OUT - Pending / IO / Serde / Objs: 3 / 1 / 0 / 7000 - Pending / IO / Serde / Objs: 6 / 1 / 1 / 14000 - Pending / IO / Serde / Objs: 7 / 1 / 0 / 19000 - Pending / IO / Serde / Objs: 6 / 1 / 0 / 20000 - Pending / IO / Serde / Objs: 2 / 1 / 0 / 20000 - O. Stats: - Wall clock time: 10.69s - Total CPU time: 3.91s - User wait time: 1.4s - Serialization time: 1.13s (28.85%) - Checksum calculation time: 513.77ms (13.13%) - Compression time: 1.33s (34.02%) - Total IO delay: 9.77s - Concurrency overhead: 1.17ms - Uncompressed size: 1.86GiB (~97.66KiB per object) - Output size: 1.86GiB (~97.66KiB per object; compression = 100%) - IO speed: 195.21MiB/s - Concurrency adjusted uncompressed speed: 1.09GiB/s - Actual uncompressed speed: 178.48MiB/s - Actual speed: 178.48MiB/s - Objects: 20000 - Average object size uncompressed: 97.66KiB - Average object size compressed: 97.66KiB - Blocks: 20 (~95.37MiB each) - Ongoing and pending ops (Serde / IO / Pending): 0 / 0 / 0 -Gradle Test Executor 1 finished executing tests. +com.milaboratory.util.JsonOverriderTest > test1 STANDARD_OUT + WARNING: unnecessary override -Ob= with the same value. WARNING: A terminally deprecated method in java.lang.System has been called WARNING: System::setSecurityManager has been called by org.gradle.api.internal.tasks.testing.worker.TestWorker (file:/usr/share/gradle/lib/plugins/gradle-testing-base-4.4.1.jar) WARNING: Please consider reporting this to the maintainers of org.gradle.api.internal.tasks.testing.worker.TestWorker WARNING: System::setSecurityManager will be removed in a future release -Finished generating test XML results (0.207 secs) into: /build/reproducible-path/milib-2.2.0+dfsg/build/test-results/test +Gradle Test Executor 1 finished executing tests. +Finished generating test XML results (0.113 secs) into: /build/reproducible-path/milib-2.2.0+dfsg/build/test-results/test Generating HTML test report... -Finished generating test html results (0.13 secs) into: /build/reproducible-path/milib-2.2.0+dfsg/build/reports/tests/test -:test (Thread[Task worker for ':' Thread 8,5,main]) completed. Took 2 mins 41.644 secs. +Finished generating test html results (0.168 secs) into: /build/reproducible-path/milib-2.2.0+dfsg/build/reports/tests/test +:test (Thread[Task worker for ':',5,main]) completed. Took 5 mins 11.995 secs. -BUILD SUCCESSFUL in 2m 51s +BUILD SUCCESSFUL in 5m 29s 5 actionable tasks: 3 executed, 2 up-to-date create-stamp debian/debhelper-build-stamp dh_prep @@ -5500,12 +5507,14 @@ dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: including full source code in upload I: copying local configuration +I: user script /srv/workspace/pbuilder/51452/tmp/hooks/B01_cleanup starting +I: user script /srv/workspace/pbuilder/51452/tmp/hooks/B01_cleanup finished I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env -I: removing directory /srv/workspace/pbuilder/73035 and its subdirectories -I: Current time: Mon Jun 2 16:42:27 -12 2025 -I: pbuilder-time-stamp: 1748925747 +I: removing directory /srv/workspace/pbuilder/51452 and its subdirectories +I: Current time: Wed May 1 12:27:21 +14 2024 +I: pbuilder-time-stamp: 1714516041