Sat May 13 07:12:27 UTC 2023 I: starting to build dawg/bookworm/i386 on jenkins on '2023-05-13 07:12' Sat May 13 07:12:27 UTC 2023 I: The jenkins build log is/was available at https://jenkins.debian.net/userContent/reproducible/debian/build_service/i386_6/9198/console.log Sat May 13 07:12:27 UTC 2023 I: Downloading source for bookworm/dawg=1.2-4 --2023-05-13 07:12:27-- http://cdn-fastly.deb.debian.org/debian/pool/main/d/dawg/dawg_1.2-4.dsc Connecting to 78.137.99.97:3128... connected. Proxy request sent, awaiting response... 200 OK Length: 1928 (1.9K) [text/prs.lines.tag] Saving to: ‘dawg_1.2-4.dsc’ 0K . 100% 144M=0s 2023-05-13 07:12:27 (144 MB/s) - ‘dawg_1.2-4.dsc’ saved [1928/1928] Sat May 13 07:12:27 UTC 2023 I: dawg_1.2-4.dsc -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA256 Format: 3.0 (quilt) Source: dawg Binary: dawg Architecture: any Version: 1.2-4 Maintainer: Debian Med Packaging Team Uploaders: Kevin Murray Homepage: https://github.com/reedacartwright/dawg Standards-Version: 4.6.0 Vcs-Browser: https://salsa.debian.org/med-team/dawg Vcs-Git: https://salsa.debian.org/med-team/dawg.git Testsuite: autopkgtest Build-Depends: debhelper-compat (= 13), cmake, bison, flex Package-List: dawg deb science optional arch=any Checksums-Sha1: f2a15e75bc7ccaa180f92e8ec14bf3b5f936b678 180312 dawg_1.2.orig.tar.gz 40437b02f787cf22d68006844cd1f518496762e7 7892 dawg_1.2-4.debian.tar.xz Checksums-Sha256: 0034d77309e538b34a395916326818a1a0d37cad789819178a905daabb41c9fe 180312 dawg_1.2.orig.tar.gz 92d0497a6417c2fcef0ef27938ec04ec046b419e58a931b64f29c0ccaea6ce3a 7892 dawg_1.2-4.debian.tar.xz Files: 369a26a5c7a905acefb566cfcb4270b9 180312 dawg_1.2.orig.tar.gz b28ac9c357153f6fbc4e85689a386d9f 7892 dawg_1.2-4.debian.tar.xz -----BEGIN PGP SIGNATURE----- iQJFBAEBCAAvFiEE8fAHMgoDVUHwpmPKV4oElNHGRtEFAmGJgW0RHHRpbGxlQGRl Ymlhbi5vcmcACgkQV4oElNHGRtGrVQ//TdS4yBHXZWk7nxsXZUJ+Xd0UqJJPBZcz 6hfYjSrrw00LxgGolpkgQZcxO+nZB3IQUaDS8wfP++kyRlKmILVJjS+XS11ymiTW Q/KlZhnLRU49rSRvhsk7/qPmZfPNUhGBNJHaTgiYu979NBhUdUzn8B1iJS1vL7Lf dWY4/qG0ZkpZrW5LQK9xfZkjgUVGr5BkfrkY3L0LlGhDD7RjvL40cAJxyhRu5jh+ OM/DjRxUC8pljlEpgK08c7HosKrOUeMtRFrITHsiyosuDHFyNHiUR+MiB0jqaY7P bKsEndVH9knWMKuNHUMet7/Ds+LhhsmVVjC17S1qzsymTpuq3PNP+kR15Afp8erb 2tvGdS8nhpxyIvZvaeoLQzlrhughFowrgBQFAelZH331wMoZNaSV1BhPW+bJvwTq xH+IYom4uT26Ruxw/1bORDgbbq4Qq72kJeH5X9Qto/dtOC78TkotVu+7pPbFM6Kq SBRQYyYZKpGK5ez83PeooNvWvxav4CbPEugbNzRNBuo4LKukbJLwYQnKP0Ad++eu gy402JUoR3ZPdvIC1xljPi7F5iLnLHvXgM6yMe8AjbYgE7K8fYP0XpkMGXUwHKLB VlT9Mnevu4IyMF7nDanoILMGlYlRofJ19wxNyPM+bIVF4sbHeOwQRi3otV0CaCgE KSUWEN/jDxs= =I2vJ -----END PGP SIGNATURE----- Sat May 13 07:12:27 UTC 2023 I: Checking whether the package is not for us Sat May 13 07:12:27 UTC 2023 I: Starting 1st build on remote node ionos6-i386.debian.net. Sat May 13 07:12:27 UTC 2023 I: Preparing to do remote build '1' on ionos6-i386.debian.net. Sat May 13 07:13:18 UTC 2023 I: Deleting $TMPDIR on ionos6-i386.debian.net. I: pbuilder: network access will be disabled during build I: Current time: Fri Jun 14 01:35:29 -12 2024 I: pbuilder-time-stamp: 1718372129 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/bookworm-reproducible-base.tgz] I: copying local configuration W: --override-config is not set; not updating apt.conf Read the manpage for details. I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: using eatmydata during job I: Copying source file I: copying [dawg_1.2-4.dsc] I: copying [./dawg_1.2.orig.tar.gz] I: copying [./dawg_1.2-4.debian.tar.xz] I: Extracting source gpgv: Signature made Mon Nov 8 07:58:37 2021 -12 gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: cannot verify inline signature for ./dawg_1.2-4.dsc: no acceptable signature found dpkg-source: info: extracting dawg in dawg-1.2 dpkg-source: info: unpacking dawg_1.2.orig.tar.gz dpkg-source: info: unpacking dawg_1.2-4.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying 0001-Add-missing-include-of-cstring.patch dpkg-source: info: applying 0003-Don-t-override-install-directories.patch dpkg-source: info: applying 0004-Fix-typo-in-help-text.patch dpkg-source: info: applying 0005-Remove-Encoding-add-Keywords-to-dawg.desktop.patch dpkg-source: info: applying 0006-relative-path-in-test-script.patch I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/53396/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='i386' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=16' DISTRIBUTION='bookworm' HOME='/root' HOST_ARCH='i386' IFS=' ' INVOCATION_ID='8072de816ca649799298aadb77b3f11a' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' LD_LIBRARY_PATH='/usr/lib/libeatmydata' LD_PRELOAD='libeatmydata.so' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='53396' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.FxwaFBap/pbuilderrc_xsUT --distribution bookworm --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bookworm-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.FxwaFBap/b1 --logfile b1/build.log dawg_1.2-4.dsc' SUDO_GID='112' SUDO_UID='107' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' _='/usr/bin/systemd-run' http_proxy='http://85.184.249.68:3128' I: uname -a Linux ionos6-i386 5.10.0-22-amd64 #1 SMP Debian 5.10.178-3 (2023-04-22) x86_64 GNU/Linux I: ls -l /bin total 6036 -rwxr-xr-x 1 root root 1408088 Apr 23 2023 bash -rwxr-xr-x 3 root root 38404 Sep 18 2022 bunzip2 -rwxr-xr-x 3 root root 38404 Sep 18 2022 bzcat lrwxrwxrwx 1 root root 6 Sep 18 2022 bzcmp -> bzdiff -rwxr-xr-x 1 root root 2225 Sep 18 2022 bzdiff lrwxrwxrwx 1 root root 6 Sep 18 2022 bzegrep -> bzgrep -rwxr-xr-x 1 root root 4893 Nov 27 2021 bzexe lrwxrwxrwx 1 root root 6 Sep 18 2022 bzfgrep -> bzgrep -rwxr-xr-x 1 root root 3775 Sep 18 2022 bzgrep -rwxr-xr-x 3 root root 38404 Sep 18 2022 bzip2 -rwxr-xr-x 1 root root 17892 Sep 18 2022 bzip2recover lrwxrwxrwx 1 root root 6 Sep 18 2022 bzless -> bzmore -rwxr-xr-x 1 root root 1297 Sep 18 2022 bzmore -rwxr-xr-x 1 root root 42920 Sep 20 2022 cat -rwxr-xr-x 1 root root 79816 Sep 20 2022 chgrp -rwxr-xr-x 1 root root 67496 Sep 20 2022 chmod -rwxr-xr-x 1 root root 79816 Sep 20 2022 chown -rwxr-xr-x 1 root root 162024 Sep 20 2022 cp -rwxr-xr-x 1 root root 136916 Jan 5 2023 dash -rwxr-xr-x 1 root root 137160 Sep 20 2022 date -rwxr-xr-x 1 root root 100364 Sep 20 2022 dd -rwxr-xr-x 1 root root 108940 Sep 20 2022 df -rwxr-xr-x 1 root root 162152 Sep 20 2022 dir -rwxr-xr-x 1 root root 87760 Mar 22 2023 dmesg lrwxrwxrwx 1 root root 8 Dec 19 2022 dnsdomainname -> hostname lrwxrwxrwx 1 root root 8 Dec 19 2022 domainname -> hostname -rwxr-xr-x 1 root root 38760 Sep 20 2022 echo -rwxr-xr-x 1 root root 41 Jan 24 2023 egrep -rwxr-xr-x 1 root root 34664 Sep 20 2022 false -rwxr-xr-x 1 root root 41 Jan 24 2023 fgrep -rwxr-xr-x 1 root root 84272 Mar 22 2023 findmnt -rwsr-xr-x 1 root root 30240 Mar 22 2023 fusermount -rwxr-xr-x 1 root root 218680 Jan 24 2023 grep -rwxr-xr-x 2 root root 2346 Apr 9 2022 gunzip -rwxr-xr-x 1 root root 6447 Apr 9 2022 gzexe -rwxr-xr-x 1 root root 100952 Apr 9 2022 gzip -rwxr-xr-x 1 root root 21916 Dec 19 2022 hostname -rwxr-xr-x 1 root root 75756 Sep 20 2022 ln -rwxr-xr-x 1 root root 55600 Mar 22 2023 login -rwxr-xr-x 1 root root 162152 Sep 20 2022 ls -rwxr-xr-x 1 root root 214568 Mar 22 2023 lsblk -rwxr-xr-x 1 root root 96328 Sep 20 2022 mkdir -rwxr-xr-x 1 root root 84008 Sep 20 2022 mknod -rwxr-xr-x 1 root root 38792 Sep 20 2022 mktemp -rwxr-xr-x 1 root root 63016 Mar 22 2023 more -rwsr-xr-x 1 root root 58912 Mar 22 2023 mount -rwxr-xr-x 1 root root 13856 Mar 22 2023 mountpoint -rwxr-xr-x 1 root root 157932 Sep 20 2022 mv lrwxrwxrwx 1 root root 8 Dec 19 2022 nisdomainname -> hostname lrwxrwxrwx 1 root root 14 Apr 2 2023 pidof -> /sbin/killall5 -rwxr-xr-x 1 root root 38792 Sep 20 2022 pwd lrwxrwxrwx 1 root root 4 Apr 23 2023 rbash -> bash -rwxr-xr-x 1 root root 51080 Sep 20 2022 readlink -rwxr-xr-x 1 root root 75720 Sep 20 2022 rm -rwxr-xr-x 1 root root 51080 Sep 20 2022 rmdir -rwxr-xr-x 1 root root 22308 Nov 2 2022 run-parts -rwxr-xr-x 1 root root 133224 Jan 5 2023 sed lrwxrwxrwx 1 root root 4 Jan 5 2023 sh -> dash -rwxr-xr-x 1 root root 38760 Sep 20 2022 sleep -rwxr-xr-x 1 root root 87976 Sep 20 2022 stty -rwsr-xr-x 1 root root 83492 Mar 22 2023 su -rwxr-xr-x 1 root root 38792 Sep 20 2022 sync -rwxr-xr-x 1 root root 598456 Apr 6 2023 tar -rwxr-xr-x 1 root root 13860 Nov 2 2022 tempfile -rwxr-xr-x 1 root root 120776 Sep 20 2022 touch -rwxr-xr-x 1 root root 34664 Sep 20 2022 true -rwxr-xr-x 1 root root 17892 Mar 22 2023 ulockmgr_server -rwsr-xr-x 1 root root 30236 Mar 22 2023 umount -rwxr-xr-x 1 root root 38760 Sep 20 2022 uname -rwxr-xr-x 2 root root 2346 Apr 9 2022 uncompress -rwxr-xr-x 1 root root 162152 Sep 20 2022 vdir -rwxr-xr-x 1 root root 71216 Mar 22 2023 wdctl lrwxrwxrwx 1 root root 8 Dec 19 2022 ypdomainname -> hostname -rwxr-xr-x 1 root root 1984 Apr 9 2022 zcat -rwxr-xr-x 1 root root 1678 Apr 9 2022 zcmp -rwxr-xr-x 1 root root 6460 Apr 9 2022 zdiff -rwxr-xr-x 1 root root 29 Apr 9 2022 zegrep -rwxr-xr-x 1 root root 29 Apr 9 2022 zfgrep -rwxr-xr-x 1 root root 2081 Apr 9 2022 zforce -rwxr-xr-x 1 root root 8103 Apr 9 2022 zgrep -rwxr-xr-x 1 root root 2206 Apr 9 2022 zless -rwxr-xr-x 1 root root 1842 Apr 9 2022 zmore -rwxr-xr-x 1 root root 4577 Apr 9 2022 znew I: user script /srv/workspace/pbuilder/53396/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: i386 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), cmake, bison, flex dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19604 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on cmake; however: Package cmake is not installed. pbuilder-satisfydepends-dummy depends on bison; however: Package bison is not installed. pbuilder-satisfydepends-dummy depends on flex; however: Package flex is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bison{a} bsdextrautils{a} cmake{a} cmake-data{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} flex{a} gettext{a} gettext-base{a} groff-base{a} intltool-debian{a} libarchive-zip-perl{a} libarchive13{a} libbrotli1{a} libcurl4{a} libdebhelper-perl{a} libelf1{a} libexpat1{a} libfile-stripnondeterminism-perl{a} libicu72{a} libjsoncpp25{a} libldap-2.5-0{a} libmagic-mgc{a} libmagic1{a} libnghttp2-14{a} libpipeline1{a} libproc2-0{a} libpsl5{a} librhash0{a} librtmp1{a} libsasl2-2{a} libsasl2-modules-db{a} libssh2-1{a} libsub-override-perl{a} libtool{a} libuchardet0{a} libuv1{a} libxml2{a} m4{a} man-db{a} po-debconf{a} procps{a} sensible-utils{a} The following packages are RECOMMENDED but will NOT be installed: ca-certificates curl libarchive-cpio-perl libfl-dev libldap-common libltdl-dev libmail-sendmail-perl libsasl2-modules lynx psmisc publicsuffix wget 0 packages upgraded, 50 newly installed, 0 to remove and 0 not upgraded. Need to get 35.4 MB of archives. After unpacking 128 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian bookworm/main i386 m4 i386 1.4.19-3 [294 kB] Get: 2 http://deb.debian.org/debian bookworm/main i386 flex i386 2.6.4-8.1 [430 kB] Get: 3 http://deb.debian.org/debian bookworm/main i386 libproc2-0 i386 2:4.0.2-3 [63.7 kB] Get: 4 http://deb.debian.org/debian bookworm/main i386 procps i386 2:4.0.2-3 [706 kB] Get: 5 http://deb.debian.org/debian bookworm/main i386 sensible-utils all 0.0.17+nmu1 [19.0 kB] Get: 6 http://deb.debian.org/debian bookworm/main i386 libmagic-mgc i386 1:5.44-3 [305 kB] Get: 7 http://deb.debian.org/debian bookworm/main i386 libmagic1 i386 1:5.44-3 [114 kB] Get: 8 http://deb.debian.org/debian bookworm/main i386 file i386 1:5.44-3 [42.5 kB] Get: 9 http://deb.debian.org/debian bookworm/main i386 gettext-base i386 0.21-12 [162 kB] Get: 10 http://deb.debian.org/debian bookworm/main i386 libuchardet0 i386 0.0.7-1 [67.9 kB] Get: 11 http://deb.debian.org/debian bookworm/main i386 groff-base i386 1.22.4-10 [932 kB] Get: 12 http://deb.debian.org/debian bookworm/main i386 bsdextrautils i386 2.38.1-5+b1 [90.3 kB] Get: 13 http://deb.debian.org/debian bookworm/main i386 libpipeline1 i386 1.5.7-1 [40.0 kB] Get: 14 http://deb.debian.org/debian bookworm/main i386 man-db i386 2.11.2-2 [1397 kB] Get: 15 http://deb.debian.org/debian bookworm/main i386 autoconf all 2.71-3 [332 kB] Get: 16 http://deb.debian.org/debian bookworm/main i386 autotools-dev all 20220109.1 [51.6 kB] Get: 17 http://deb.debian.org/debian bookworm/main i386 automake all 1:1.16.5-1.3 [823 kB] Get: 18 http://deb.debian.org/debian bookworm/main i386 autopoint all 0.21-12 [495 kB] Get: 19 http://deb.debian.org/debian bookworm/main i386 bison i386 2:3.8.2+dfsg-1+b1 [1186 kB] Get: 20 http://deb.debian.org/debian bookworm/main i386 libicu72 i386 72.1-3 [9541 kB] Get: 21 http://deb.debian.org/debian bookworm/main i386 libxml2 i386 2.9.14+dfsg-1.2 [720 kB] Get: 22 http://deb.debian.org/debian bookworm/main i386 libarchive13 i386 3.6.2-1 [385 kB] Get: 23 http://deb.debian.org/debian bookworm/main i386 libbrotli1 i386 1.0.9-2+b6 [275 kB] Get: 24 http://deb.debian.org/debian bookworm/main i386 libsasl2-modules-db i386 2.1.28+dfsg-10 [21.4 kB] Get: 25 http://deb.debian.org/debian bookworm/main i386 libsasl2-2 i386 2.1.28+dfsg-10 [62.7 kB] Get: 26 http://deb.debian.org/debian bookworm/main i386 libldap-2.5-0 i386 2.5.13+dfsg-5 [196 kB] Get: 27 http://deb.debian.org/debian bookworm/main i386 libnghttp2-14 i386 1.52.0-1 [79.8 kB] Get: 28 http://deb.debian.org/debian bookworm/main i386 libpsl5 i386 0.21.2-1 [59.3 kB] Get: 29 http://deb.debian.org/debian bookworm/main i386 librtmp1 i386 2.4+20151223.gitfa8646d.1-2+b2 [64.3 kB] Get: 30 http://deb.debian.org/debian bookworm/main i386 libssh2-1 i386 1.10.0-3+b1 [187 kB] Get: 31 http://deb.debian.org/debian bookworm/main i386 libcurl4 i386 7.88.1-9 [420 kB] Get: 32 http://deb.debian.org/debian bookworm/main i386 libexpat1 i386 2.5.0-1 [103 kB] Get: 33 http://deb.debian.org/debian bookworm/main i386 libjsoncpp25 i386 1.9.5-4 [86.2 kB] Get: 34 http://deb.debian.org/debian bookworm/main i386 librhash0 i386 1.4.3-3 [149 kB] Get: 35 http://deb.debian.org/debian bookworm/main i386 libuv1 i386 1.44.2-1 [147 kB] Get: 36 http://deb.debian.org/debian bookworm/main i386 cmake-data all 3.25.1-1 [2026 kB] Get: 37 http://deb.debian.org/debian bookworm/main i386 cmake i386 3.25.1-1 [9767 kB] Get: 38 http://deb.debian.org/debian bookworm/main i386 libdebhelper-perl all 13.11.4 [81.2 kB] Get: 39 http://deb.debian.org/debian bookworm/main i386 libtool all 2.4.7-5 [517 kB] Get: 40 http://deb.debian.org/debian bookworm/main i386 dh-autoreconf all 20 [17.1 kB] Get: 41 http://deb.debian.org/debian bookworm/main i386 libarchive-zip-perl all 1.68-1 [104 kB] Get: 42 http://deb.debian.org/debian bookworm/main i386 libsub-override-perl all 0.09-4 [9304 B] Get: 43 http://deb.debian.org/debian bookworm/main i386 libfile-stripnondeterminism-perl all 1.13.1-1 [19.4 kB] Get: 44 http://deb.debian.org/debian bookworm/main i386 dh-strip-nondeterminism all 1.13.1-1 [8620 B] Get: 45 http://deb.debian.org/debian bookworm/main i386 libelf1 i386 0.188-2.1 [179 kB] Get: 46 http://deb.debian.org/debian bookworm/main i386 dwz i386 0.15-1 [118 kB] Get: 47 http://deb.debian.org/debian bookworm/main i386 gettext i386 0.21-12 [1311 kB] Get: 48 http://deb.debian.org/debian bookworm/main i386 intltool-debian all 0.35.0+20060710.6 [22.9 kB] Get: 49 http://deb.debian.org/debian bookworm/main i386 po-debconf all 1.0.21+nmu1 [248 kB] Get: 50 http://deb.debian.org/debian bookworm/main i386 debhelper all 13.11.4 [942 kB] Fetched 35.4 MB in 1s (57.6 MB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package m4. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19604 files and directories currently installed.) Preparing to unpack .../00-m4_1.4.19-3_i386.deb ... Unpacking m4 (1.4.19-3) ... Selecting previously unselected package flex. Preparing to unpack .../01-flex_2.6.4-8.1_i386.deb ... Unpacking flex (2.6.4-8.1) ... Selecting previously unselected package libproc2-0:i386. Preparing to unpack .../02-libproc2-0_2%3a4.0.2-3_i386.deb ... Unpacking libproc2-0:i386 (2:4.0.2-3) ... Selecting previously unselected package procps. Preparing to unpack .../03-procps_2%3a4.0.2-3_i386.deb ... Unpacking procps (2:4.0.2-3) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../04-sensible-utils_0.0.17+nmu1_all.deb ... Unpacking sensible-utils (0.0.17+nmu1) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../05-libmagic-mgc_1%3a5.44-3_i386.deb ... Unpacking libmagic-mgc (1:5.44-3) ... Selecting previously unselected package libmagic1:i386. Preparing to unpack .../06-libmagic1_1%3a5.44-3_i386.deb ... Unpacking libmagic1:i386 (1:5.44-3) ... Selecting previously unselected package file. Preparing to unpack .../07-file_1%3a5.44-3_i386.deb ... Unpacking file (1:5.44-3) ... Selecting previously unselected package gettext-base. Preparing to unpack .../08-gettext-base_0.21-12_i386.deb ... Unpacking gettext-base (0.21-12) ... Selecting previously unselected package libuchardet0:i386. Preparing to unpack .../09-libuchardet0_0.0.7-1_i386.deb ... Unpacking libuchardet0:i386 (0.0.7-1) ... Selecting previously unselected package groff-base. Preparing to unpack .../10-groff-base_1.22.4-10_i386.deb ... Unpacking groff-base (1.22.4-10) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../11-bsdextrautils_2.38.1-5+b1_i386.deb ... Unpacking bsdextrautils (2.38.1-5+b1) ... Selecting previously unselected package libpipeline1:i386. Preparing to unpack .../12-libpipeline1_1.5.7-1_i386.deb ... Unpacking libpipeline1:i386 (1.5.7-1) ... Selecting previously unselected package man-db. Preparing to unpack .../13-man-db_2.11.2-2_i386.deb ... Unpacking man-db (2.11.2-2) ... Selecting previously unselected package autoconf. Preparing to unpack .../14-autoconf_2.71-3_all.deb ... Unpacking autoconf (2.71-3) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../15-autotools-dev_20220109.1_all.deb ... Unpacking autotools-dev (20220109.1) ... Selecting previously unselected package automake. Preparing to unpack .../16-automake_1%3a1.16.5-1.3_all.deb ... Unpacking automake (1:1.16.5-1.3) ... Selecting previously unselected package autopoint. Preparing to unpack .../17-autopoint_0.21-12_all.deb ... Unpacking autopoint (0.21-12) ... Selecting previously unselected package bison. Preparing to unpack .../18-bison_2%3a3.8.2+dfsg-1+b1_i386.deb ... Unpacking bison (2:3.8.2+dfsg-1+b1) ... Selecting previously unselected package libicu72:i386. Preparing to unpack .../19-libicu72_72.1-3_i386.deb ... Unpacking libicu72:i386 (72.1-3) ... Selecting previously unselected package libxml2:i386. Preparing to unpack .../20-libxml2_2.9.14+dfsg-1.2_i386.deb ... Unpacking libxml2:i386 (2.9.14+dfsg-1.2) ... Selecting previously unselected package libarchive13:i386. Preparing to unpack .../21-libarchive13_3.6.2-1_i386.deb ... Unpacking libarchive13:i386 (3.6.2-1) ... Selecting previously unselected package libbrotli1:i386. Preparing to unpack .../22-libbrotli1_1.0.9-2+b6_i386.deb ... Unpacking libbrotli1:i386 (1.0.9-2+b6) ... Selecting previously unselected package libsasl2-modules-db:i386. Preparing to unpack .../23-libsasl2-modules-db_2.1.28+dfsg-10_i386.deb ... Unpacking libsasl2-modules-db:i386 (2.1.28+dfsg-10) ... Selecting previously unselected package libsasl2-2:i386. Preparing to unpack .../24-libsasl2-2_2.1.28+dfsg-10_i386.deb ... Unpacking libsasl2-2:i386 (2.1.28+dfsg-10) ... Selecting previously unselected package libldap-2.5-0:i386. Preparing to unpack .../25-libldap-2.5-0_2.5.13+dfsg-5_i386.deb ... Unpacking libldap-2.5-0:i386 (2.5.13+dfsg-5) ... Selecting previously unselected package libnghttp2-14:i386. Preparing to unpack .../26-libnghttp2-14_1.52.0-1_i386.deb ... Unpacking libnghttp2-14:i386 (1.52.0-1) ... Selecting previously unselected package libpsl5:i386. Preparing to unpack .../27-libpsl5_0.21.2-1_i386.deb ... Unpacking libpsl5:i386 (0.21.2-1) ... Selecting previously unselected package librtmp1:i386. Preparing to unpack .../28-librtmp1_2.4+20151223.gitfa8646d.1-2+b2_i386.deb ... Unpacking librtmp1:i386 (2.4+20151223.gitfa8646d.1-2+b2) ... Selecting previously unselected package libssh2-1:i386. Preparing to unpack .../29-libssh2-1_1.10.0-3+b1_i386.deb ... Unpacking libssh2-1:i386 (1.10.0-3+b1) ... Selecting previously unselected package libcurl4:i386. Preparing to unpack .../30-libcurl4_7.88.1-9_i386.deb ... Unpacking libcurl4:i386 (7.88.1-9) ... Selecting previously unselected package libexpat1:i386. Preparing to unpack .../31-libexpat1_2.5.0-1_i386.deb ... Unpacking libexpat1:i386 (2.5.0-1) ... Selecting previously unselected package libjsoncpp25:i386. Preparing to unpack .../32-libjsoncpp25_1.9.5-4_i386.deb ... Unpacking libjsoncpp25:i386 (1.9.5-4) ... Selecting previously unselected package librhash0:i386. Preparing to unpack .../33-librhash0_1.4.3-3_i386.deb ... Unpacking librhash0:i386 (1.4.3-3) ... Selecting previously unselected package libuv1:i386. Preparing to unpack .../34-libuv1_1.44.2-1_i386.deb ... Unpacking libuv1:i386 (1.44.2-1) ... Selecting previously unselected package cmake-data. Preparing to unpack .../35-cmake-data_3.25.1-1_all.deb ... Unpacking cmake-data (3.25.1-1) ... Selecting previously unselected package cmake. Preparing to unpack .../36-cmake_3.25.1-1_i386.deb ... Unpacking cmake (3.25.1-1) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../37-libdebhelper-perl_13.11.4_all.deb ... Unpacking libdebhelper-perl (13.11.4) ... Selecting previously unselected package libtool. Preparing to unpack .../38-libtool_2.4.7-5_all.deb ... Unpacking libtool (2.4.7-5) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../39-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../40-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libsub-override-perl. Preparing to unpack .../41-libsub-override-perl_0.09-4_all.deb ... Unpacking libsub-override-perl (0.09-4) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../42-libfile-stripnondeterminism-perl_1.13.1-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.13.1-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../43-dh-strip-nondeterminism_1.13.1-1_all.deb ... Unpacking dh-strip-nondeterminism (1.13.1-1) ... Selecting previously unselected package libelf1:i386. Preparing to unpack .../44-libelf1_0.188-2.1_i386.deb ... Unpacking libelf1:i386 (0.188-2.1) ... Selecting previously unselected package dwz. Preparing to unpack .../45-dwz_0.15-1_i386.deb ... Unpacking dwz (0.15-1) ... Selecting previously unselected package gettext. Preparing to unpack .../46-gettext_0.21-12_i386.deb ... Unpacking gettext (0.21-12) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../47-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../48-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../49-debhelper_13.11.4_all.deb ... Unpacking debhelper (13.11.4) ... Setting up libexpat1:i386 (2.5.0-1) ... Setting up libpipeline1:i386 (1.5.7-1) ... Setting up libpsl5:i386 (0.21.2-1) ... Setting up libicu72:i386 (72.1-3) ... Setting up bsdextrautils (2.38.1-5+b1) ... Setting up libmagic-mgc (1:5.44-3) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libdebhelper-perl (13.11.4) ... Setting up libbrotli1:i386 (1.0.9-2+b6) ... Setting up libnghttp2-14:i386 (1.52.0-1) ... Setting up libmagic1:i386 (1:5.44-3) ... Setting up gettext-base (0.21-12) ... Setting up m4 (1.4.19-3) ... Setting up file (1:5.44-3) ... Setting up libsasl2-modules-db:i386 (2.1.28+dfsg-10) ... Setting up autotools-dev (20220109.1) ... Setting up libuv1:i386 (1.44.2-1) ... Setting up librtmp1:i386 (2.4+20151223.gitfa8646d.1-2+b2) ... Setting up libproc2-0:i386 (2:4.0.2-3) ... Setting up autopoint (0.21-12) ... Setting up libjsoncpp25:i386 (1.9.5-4) ... Setting up libsasl2-2:i386 (2.1.28+dfsg-10) ... Setting up autoconf (2.71-3) ... Setting up sensible-utils (0.0.17+nmu1) ... Setting up librhash0:i386 (1.4.3-3) ... Setting up libuchardet0:i386 (0.0.7-1) ... Setting up procps (2:4.0.2-3) ... Setting up bison (2:3.8.2+dfsg-1+b1) ... update-alternatives: using /usr/bin/bison.yacc to provide /usr/bin/yacc (yacc) in auto mode Setting up libsub-override-perl (0.09-4) ... Setting up libssh2-1:i386 (1.10.0-3+b1) ... Setting up cmake-data (3.25.1-1) ... Setting up libelf1:i386 (0.188-2.1) ... Setting up libxml2:i386 (2.9.14+dfsg-1.2) ... Setting up automake (1:1.16.5-1.3) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up libfile-stripnondeterminism-perl (1.13.1-1) ... Setting up flex (2.6.4-8.1) ... Setting up gettext (0.21-12) ... Setting up libtool (2.4.7-5) ... Setting up libarchive13:i386 (3.6.2-1) ... Setting up libldap-2.5-0:i386 (2.5.13+dfsg-5) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up dh-autoreconf (20) ... Setting up dh-strip-nondeterminism (1.13.1-1) ... Setting up dwz (0.15-1) ... Setting up groff-base (1.22.4-10) ... Setting up libcurl4:i386 (7.88.1-9) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up man-db (2.11.2-2) ... Not building database; man-db/auto-update is not 'true'. Setting up cmake (3.25.1-1) ... Setting up debhelper (13.11.4) ... Processing triggers for libc-bin (2.36-9) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps I: Building the package I: Running cd /build/dawg-1.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../dawg_1.2-4_source.changes dpkg-buildpackage: info: source package dawg dpkg-buildpackage: info: source version 1.2-4 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Andreas Tille dpkg-source --before-build . dpkg-buildpackage: info: host architecture i386 debian/rules clean dh clean dh_clean debian/rules binary dh binary dh_update_autotools_config dh_autoreconf debian/rules override_dh_auto_configure make[1]: Entering directory '/build/dawg-1.2' dh_auto_configure -- \ -DCMAKE_LIBRARY_PATH=i386-linux-gnu \ -DCMAKE_DATA_DIR=/usr/share/doc/dawg cd obj-i686-linux-gnu && cmake -DCMAKE_INSTALL_PREFIX=/usr -DCMAKE_BUILD_TYPE=None -DCMAKE_INSTALL_SYSCONFDIR=/etc -DCMAKE_INSTALL_LOCALSTATEDIR=/var -DCMAKE_EXPORT_NO_PACKAGE_REGISTRY=ON -DCMAKE_FIND_USE_PACKAGE_REGISTRY=OFF -DCMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY=ON -DFETCHCONTENT_FULLY_DISCONNECTED=ON -DCMAKE_INSTALL_RUNSTATEDIR=/run -DCMAKE_SKIP_INSTALL_ALL_DEPENDENCY=ON "-GUnix Makefiles" -DCMAKE_VERBOSE_MAKEFILE=ON -DCMAKE_INSTALL_LIBDIR=lib/i386-linux-gnu -DCMAKE_LIBRARY_PATH=i386-linux-gnu -DCMAKE_DATA_DIR=/usr/share/doc/dawg .. CMake Deprecation Warning at CMakeLists.txt:5 (CMAKE_MINIMUM_REQUIRED): Compatibility with CMake < 2.8.12 will be removed from a future version of CMake. Update the VERSION argument value or use a ... suffix to tell CMake that the project does not need compatibility with older versions. -- The C compiler identification is GNU 12.2.0 -- The CXX compiler identification is GNU 12.2.0 -- Detecting C compiler ABI info -- Detecting C compiler ABI info - done -- Check for working C compiler: /usr/bin/cc - skipped -- Detecting C compile features -- Detecting C compile features - done -- Detecting CXX compiler ABI info -- Detecting CXX compiler ABI info - done -- Check for working CXX compiler: /usr/bin/c++ - skipped -- Detecting CXX compile features -- Detecting CXX compile features - done -- Looking for bison -- Looking for bison -- /usr/bin/bison -- Looking for flex -- Looking for flex -- /usr/bin/flex -- Looking for unistd.h -- Looking for unistd.h - found -- Looking for process.h -- Looking for process.h - not found -- Looking for io.h -- Looking for io.h - not found -- Looking for getopt.h -- Looking for getopt.h - found -- Looking for stdint.h -- Looking for stdint.h - found -- Looking for sys/types.h -- Looking for sys/types.h - found -- Looking for getpid -- Looking for getpid - found -- Looking for _getpid -- Looking for _getpid - not found -- Looking for copysign -- Looking for copysign - found -- Looking for _copysign -- Looking for _copysign - not found -- Looking for snprintf -- Looking for snprintf - found -- Looking for _snprintf -- Looking for _snprintf - not found -- Configuring done -- Generating done CMake Warning: Manually-specified variables were not used by the project: CMAKE_EXPORT_NO_PACKAGE_REGISTRY CMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY CMAKE_FIND_USE_PACKAGE_REGISTRY CMAKE_INSTALL_LIBDIR CMAKE_INSTALL_LOCALSTATEDIR CMAKE_INSTALL_RUNSTATEDIR CMAKE_INSTALL_SYSCONFDIR CMAKE_LIBRARY_PATH FETCHCONTENT_FULLY_DISCONNECTED -- Build files have been written to: /build/dawg-1.2/obj-i686-linux-gnu make[1]: Leaving directory '/build/dawg-1.2' dh_auto_build cd obj-i686-linux-gnu && make -j16 "INSTALL=install --strip-program=true" VERBOSE=1 make[1]: Entering directory '/build/dawg-1.2/obj-i686-linux-gnu' /usr/bin/cmake -S/build/dawg-1.2 -B/build/dawg-1.2/obj-i686-linux-gnu --check-build-system CMakeFiles/Makefile.cmake 0 /usr/bin/cmake -E cmake_progress_start /build/dawg-1.2/obj-i686-linux-gnu/CMakeFiles /build/dawg-1.2/obj-i686-linux-gnu//CMakeFiles/progress.marks make -f CMakeFiles/Makefile2 all make[2]: Entering directory '/build/dawg-1.2/obj-i686-linux-gnu' make -f src/CMakeFiles/dawg.dir/build.make src/CMakeFiles/dawg.dir/depend make[3]: Entering directory '/build/dawg-1.2/obj-i686-linux-gnu' [ 15%] Generating parser.tab.cpp, parser.tab.hpp [ 15%] Generating lex.parser.cpp cd /build/dawg-1.2/obj-i686-linux-gnu/src && /usr/bin/flex -Pparser -o/build/dawg-1.2/obj-i686-linux-gnu/src/lex.parser.cpp /build/dawg-1.2/src/parser.lpp cd /build/dawg-1.2/obj-i686-linux-gnu/src && /usr/bin/bison --name-prefix=parser --defines --output-file=/build/dawg-1.2/obj-i686-linux-gnu/src/parser.tab.cpp /build/dawg-1.2/src/parser.ypp cd /build/dawg-1.2/obj-i686-linux-gnu && /usr/bin/cmake -E cmake_depends "Unix Makefiles" /build/dawg-1.2 /build/dawg-1.2/src /build/dawg-1.2/obj-i686-linux-gnu /build/dawg-1.2/obj-i686-linux-gnu/src /build/dawg-1.2/obj-i686-linux-gnu/src/CMakeFiles/dawg.dir/DependInfo.cmake --color= make[3]: Leaving directory '/build/dawg-1.2/obj-i686-linux-gnu' make -f src/CMakeFiles/dawg.dir/build.make src/CMakeFiles/dawg.dir/build make[3]: Entering directory '/build/dawg-1.2/obj-i686-linux-gnu' [ 23%] Building CXX object src/CMakeFiles/dawg.dir/dawg.cpp.o cd /build/dawg-1.2/obj-i686-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-i686-linux-gnu/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -MD -MT src/CMakeFiles/dawg.dir/dawg.cpp.o -MF CMakeFiles/dawg.dir/dawg.cpp.o.d -o CMakeFiles/dawg.dir/dawg.cpp.o -c /build/dawg-1.2/src/dawg.cpp [ 30%] Building CXX object src/CMakeFiles/dawg.dir/eigen.cpp.o [ 38%] Building CXX object src/CMakeFiles/dawg.dir/indel.cpp.o cd /build/dawg-1.2/obj-i686-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-i686-linux-gnu/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -MD -MT src/CMakeFiles/dawg.dir/eigen.cpp.o -MF CMakeFiles/dawg.dir/eigen.cpp.o.d -o CMakeFiles/dawg.dir/eigen.cpp.o -c /build/dawg-1.2/src/eigen.cpp cd /build/dawg-1.2/obj-i686-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-i686-linux-gnu/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -MD -MT src/CMakeFiles/dawg.dir/indel.cpp.o -MF CMakeFiles/dawg.dir/indel.cpp.o.d -o CMakeFiles/dawg.dir/indel.cpp.o -c /build/dawg-1.2/src/indel.cpp [ 46%] Building CXX object src/CMakeFiles/dawg.dir/output.cpp.o [ 53%] Building CXX object src/CMakeFiles/dawg.dir/matrix.cpp.o cd /build/dawg-1.2/obj-i686-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-i686-linux-gnu/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -MD -MT src/CMakeFiles/dawg.dir/output.cpp.o -MF CMakeFiles/dawg.dir/output.cpp.o.d -o CMakeFiles/dawg.dir/output.cpp.o -c /build/dawg-1.2/src/output.cpp cd /build/dawg-1.2/obj-i686-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-i686-linux-gnu/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -MD -MT src/CMakeFiles/dawg.dir/matrix.cpp.o -MF CMakeFiles/dawg.dir/matrix.cpp.o.d -o CMakeFiles/dawg.dir/matrix.cpp.o -c /build/dawg-1.2/src/matrix.cpp [ 61%] Building CXX object src/CMakeFiles/dawg.dir/rand.cpp.o [ 69%] Building CXX object src/CMakeFiles/dawg.dir/tree.cpp.o cd /build/dawg-1.2/obj-i686-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-i686-linux-gnu/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -MD -MT src/CMakeFiles/dawg.dir/rand.cpp.o -MF CMakeFiles/dawg.dir/rand.cpp.o.d -o CMakeFiles/dawg.dir/rand.cpp.o -c /build/dawg-1.2/src/rand.cpp [ 76%] Building CXX object src/CMakeFiles/dawg.dir/var.cpp.o cd /build/dawg-1.2/obj-i686-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-i686-linux-gnu/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -MD -MT src/CMakeFiles/dawg.dir/tree.cpp.o -MF CMakeFiles/dawg.dir/tree.cpp.o.d -o CMakeFiles/dawg.dir/tree.cpp.o -c /build/dawg-1.2/src/tree.cpp [ 84%] Building CXX object src/CMakeFiles/dawg.dir/lex.parser.cpp.o [ 92%] Building CXX object src/CMakeFiles/dawg.dir/parser.tab.cpp.o cd /build/dawg-1.2/obj-i686-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-i686-linux-gnu/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -MD -MT src/CMakeFiles/dawg.dir/var.cpp.o -MF CMakeFiles/dawg.dir/var.cpp.o.d -o CMakeFiles/dawg.dir/var.cpp.o -c /build/dawg-1.2/src/var.cpp cd /build/dawg-1.2/obj-i686-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-i686-linux-gnu/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -I "/build/dawg-1.2/src" -MD -MT src/CMakeFiles/dawg.dir/lex.parser.cpp.o -MF CMakeFiles/dawg.dir/lex.parser.cpp.o.d -o CMakeFiles/dawg.dir/lex.parser.cpp.o -c /build/dawg-1.2/obj-i686-linux-gnu/src/lex.parser.cpp cd /build/dawg-1.2/obj-i686-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-i686-linux-gnu/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -I "/build/dawg-1.2/src" -MD -MT src/CMakeFiles/dawg.dir/parser.tab.cpp.o -MF CMakeFiles/dawg.dir/parser.tab.cpp.o.d -o CMakeFiles/dawg.dir/parser.tab.cpp.o -c /build/dawg-1.2/obj-i686-linux-gnu/src/parser.tab.cpp In file included from /build/dawg-1.2/src/tree.h:7, from /build/dawg-1.2/src/dawg.cpp:20: /build/dawg-1.2/src/indel.h:72:32: warning: 'template struct std::unary_function' is deprecated [-Wdeprecated-declarations] 72 | class LinearFunc : public std::unary_function | ^~~~~~~~~~~~~~ In file included from /usr/include/c++/12/bits/refwrap.h:39, from /usr/include/c++/12/vector:66, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/12/bits/stl_function.h:117:12: note: declared here 117 | struct unary_function | ^~~~~~~~~~~~~~ /build/dawg-1.2/src/tree.h:17:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/12/memory:76, from /build/dawg-1.2/src/dawg.h:48: /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:18:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:199:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:200:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.h:7, from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.ypp:5: /build/dawg-1.2/src/indel.h:72:32: warning: 'template struct std::unary_function' is deprecated [-Wdeprecated-declarations] 72 | class LinearFunc : public std::unary_function | ^~~~~~~~~~~~~~ In file included from /usr/include/c++/12/bits/refwrap.h:39, from /usr/include/c++/12/vector:66, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/parser.ypp:4: /usr/include/c++/12/bits/stl_function.h:117:12: note: declared here 117 | struct unary_function | ^~~~~~~~~~~~~~ /build/dawg-1.2/src/tree.h:17:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/12/memory:76, from /build/dawg-1.2/src/dawg.h:48: /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:18:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:199:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:200:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.h:7, from /build/dawg-1.2/src/tree.cpp:4: /build/dawg-1.2/src/indel.h:72:32: warning: 'template struct std::unary_function' is deprecated [-Wdeprecated-declarations] 72 | class LinearFunc : public std::unary_function | ^~~~~~~~~~~~~~ In file included from /usr/include/c++/12/bits/refwrap.h:39, from /usr/include/c++/12/vector:66, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/tree.cpp:3: /usr/include/c++/12/bits/stl_function.h:117:12: note: declared here 117 | struct unary_function | ^~~~~~~~~~~~~~ /build/dawg-1.2/src/tree.h:17:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/12/memory:76, from /build/dawg-1.2/src/dawg.h:48: /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:18:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.h:7, from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/var.cpp:4: /build/dawg-1.2/src/indel.h:72:32: warning: 'template struct std::unary_function' is deprecated [-Wdeprecated-declarations] 72 | class LinearFunc : public std::unary_function | ^~~~~~~~~~~~~~ In file included from /usr/include/c++/12/bits/refwrap.h:39, from /usr/include/c++/12/vector:66, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/var.cpp:3: /usr/include/c++/12/bits/stl_function.h:117:12: note: declared here 117 | struct unary_function | ^~~~~~~~~~~~~~ /build/dawg-1.2/src/tree.h:17:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/12/memory:76, from /build/dawg-1.2/src/dawg.h:48: /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:18:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:199:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:200:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:199:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:200:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.h:7, from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.lpp:5: /build/dawg-1.2/src/indel.h:72:32: warning: 'template struct std::unary_function' is deprecated [-Wdeprecated-declarations] 72 | class LinearFunc : public std::unary_function | ^~~~~~~~~~~~~~ In file included from /usr/include/c++/12/bits/refwrap.h:39, from /usr/include/c++/12/vector:66, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/parser.lpp:4: /usr/include/c++/12/bits/stl_function.h:117:12: note: declared here 117 | struct unary_function | ^~~~~~~~~~~~~~ /build/dawg-1.2/src/tree.h:17:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/12/memory:76, from /build/dawg-1.2/src/dawg.h:48: /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:18:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/indel.cpp:4: /build/dawg-1.2/src/indel.h:72:32: warning: 'template struct std::unary_function' is deprecated [-Wdeprecated-declarations] 72 | class LinearFunc : public std::unary_function | ^~~~~~~~~~~~~~ In file included from /usr/include/c++/12/bits/refwrap.h:39, from /usr/include/c++/12/vector:66, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/indel.cpp:3: /usr/include/c++/12/bits/stl_function.h:117:12: note: declared here 117 | struct unary_function | ^~~~~~~~~~~~~~ /build/dawg-1.2/src/tree.h:199:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:200:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.h:7, from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/output.cpp:4: /build/dawg-1.2/src/indel.h:72:32: warning: 'template struct std::unary_function' is deprecated [-Wdeprecated-declarations] 72 | class LinearFunc : public std::unary_function | ^~~~~~~~~~~~~~ In file included from /usr/include/c++/12/bits/refwrap.h:39, from /usr/include/c++/12/vector:66, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/output.cpp:3: /usr/include/c++/12/bits/stl_function.h:117:12: note: declared here 117 | struct unary_function | ^~~~~~~~~~~~~~ /build/dawg-1.2/src/tree.h:17:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/12/memory:76, from /build/dawg-1.2/src/dawg.h:48: /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:18:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:199:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ /build/dawg-1.2/src/tree.h:200:14: warning: 'template class std::auto_ptr' is deprecated: use 'std::unique_ptr' instead [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ /usr/include/c++/12/bits/unique_ptr.h:64:28: note: declared here 64 | template class auto_ptr; | ^~~~~~~~ [100%] Linking CXX executable dawg cd /build/dawg-1.2/obj-i686-linux-gnu/src && /usr/bin/cmake -E cmake_link_script CMakeFiles/dawg.dir/link.txt --verbose=1 /usr/bin/c++ -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -Wl,-z,relro -Wl,-z,now -rdynamic CMakeFiles/dawg.dir/dawg.cpp.o CMakeFiles/dawg.dir/eigen.cpp.o CMakeFiles/dawg.dir/indel.cpp.o CMakeFiles/dawg.dir/matrix.cpp.o CMakeFiles/dawg.dir/output.cpp.o CMakeFiles/dawg.dir/rand.cpp.o CMakeFiles/dawg.dir/tree.cpp.o CMakeFiles/dawg.dir/var.cpp.o CMakeFiles/dawg.dir/lex.parser.cpp.o CMakeFiles/dawg.dir/parser.tab.cpp.o -o dawg make[3]: Leaving directory '/build/dawg-1.2/obj-i686-linux-gnu' [100%] Built target dawg make[2]: Leaving directory '/build/dawg-1.2/obj-i686-linux-gnu' /usr/bin/cmake -E cmake_progress_start /build/dawg-1.2/obj-i686-linux-gnu/CMakeFiles 0 make[1]: Leaving directory '/build/dawg-1.2/obj-i686-linux-gnu' debian/rules override_dh_auto_test make[1]: Entering directory '/build/dawg-1.2' # FIXME: This test fails - but let the build pass anyway for the moment # see https://github.com/reedacartwright/dawg/issues/56 cd tests && PATH=$PATH:/build/dawg-1.2/obj-i686-linux-gnu/src sh test0.sh || true 2,3c2,3 < TCCTTGACCAGTTAGCAAGACGATATGCATCAAGTGCACTGGC---GTAAGTCTTTTTAC < GCTGATCATA--TAGTCCGTATAGTCACTGAACGCCGTCCTCTCG --- > AGGAACTGGTCACGTTCTGCTATACGTAGTTCACGTGACCGCATTCAGAAAAATGCGACT > AGTATTGTGATCAGGCATATCAGTGACTTGCGGCAGGAGAGC 6,7c6,7 < TCGTTGGACAGT--GCAAGACGCTATGCATCAAGTGCACTGGCTAGGTAAGTGCGTTTAT < GATGAGCACAACAGGTCCGGATAGTCCCTGAACGCTATACTCCCG --- > AGCAACTTGTCACGTTCTGCGATACGTAGTTCACGTGACCGCATTCACGCAAACACTACT > TGTGCT--GACCATGCATATCAGGGACTTGCGACATGTGGGC 10,11c10,11 < TCGA-CCCCAAA--TTAATACGTTAGTCATCAAGTGCACTGAC---GTAATAGCGTTTAT < GATGATGAGTACTAGCCCGTGGAAACCCTAAAAGCGTTACCCCCG --- > AGCATGGTGTCAAGTTCTGCGTTCAGTAGTTAACCAGACGGCATTAACGCTAATACATC- > -GTGTT--GACCTACCAACGTACGGACTTGCGTAATGTGGTC 14,15c14,15 < TCGTTGAACAGT--GCAAGACGCTATGCATCAAGTGCACTGGC---GTAAGTGCGTTTAT < GATGAACACAACTGGTCCGTATAGTCCCTGAACGCTGTACTCCCG --- > AGCAACTTGTCACGTTCTGCGATACGTAGTTCACGTGACCGCATTCACGCAAATACTACT > TGTGTT--GACCAGGCATATCAGGGACTTGCGACATGAGGGC 18,19c18,19 < TCGTACCACAGT--TCAAGACGCTAGGCATCAAGTGCACTGGC---GTAATTGCGTTTAT < GATGGACACAACTAGTCCGTTGAATCCCTGAACGCTTTACCCCCG --- > AGCATGGTGTCAAGTTCTGCGATCCGTAGTTCACGTGACCGCATTAACGCAAATACTACC > TGTGTT--GATCAGGCAACTTAGGGACTTGCGAAATGGGGGC make[1]: Leaving directory '/build/dawg-1.2' create-stamp debian/debhelper-build-stamp dh_prep dh_auto_install --destdir=debian/dawg/ cd obj-i686-linux-gnu && make -j16 install DESTDIR=/build/dawg-1.2/debian/dawg AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/dawg-1.2/obj-i686-linux-gnu' /usr/bin/cmake -S/build/dawg-1.2 -B/build/dawg-1.2/obj-i686-linux-gnu --check-build-system CMakeFiles/Makefile.cmake 0 make -f CMakeFiles/Makefile2 preinstall make[2]: Entering directory '/build/dawg-1.2/obj-i686-linux-gnu' make[2]: Nothing to be done for 'preinstall'. make[2]: Leaving directory '/build/dawg-1.2/obj-i686-linux-gnu' Install the project... /usr/bin/cmake -P cmake_install.cmake -- Install configuration: "None" -- Installing: /build/dawg-1.2/debian/dawg/usr/bin/dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/applications/dawg.desktop -- Installing: /build/dawg-1.2/debian/dawg/usr/share/pixmaps/dawg.png -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example0.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example1.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example2.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example3.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example4.dawg make[1]: Leaving directory '/build/dawg-1.2/obj-i686-linux-gnu' dh_install dh_installdocs dh_installchangelogs dh_installman dh_perl dh_link dh_strip_nondeterminism dh_compress debian/rules override_dh_fixperms make[1]: Entering directory '/build/dawg-1.2' dh_fixperms chmod -x debian/dawg/usr/share/doc/dawg/examples/* make[1]: Leaving directory '/build/dawg-1.2' dh_missing dh_dwz -a dh_strip -a dh_makeshlibs -a dh_shlibdeps -a dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'dawg' in '../dawg_1.2-4_i386.deb'. dpkg-deb: building package 'dawg-dbgsym' in '../dawg-dbgsym_1.2-4_i386.deb'. dpkg-genbuildinfo --build=binary -O../dawg_1.2-4_i386.buildinfo dpkg-genchanges --build=binary -O../dawg_1.2-4_i386.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/53396 and its subdirectories I: Current time: Fri Jun 14 01:36:16 -12 2024 I: pbuilder-time-stamp: 1718372176 Sat May 13 07:13:18 UTC 2023 I: 1st build successful. Starting 2nd build on remote node ionos12-i386.debian.net. Sat May 13 07:13:18 UTC 2023 I: Preparing to do remote build '2' on ionos12-i386.debian.net. Sat May 13 07:14:15 UTC 2023 I: Deleting $TMPDIR on ionos12-i386.debian.net. Sat May 13 07:14:15 UTC 2023 I: dawg_1.2-4_i386.changes: Format: 1.8 Date: Mon, 08 Nov 2021 20:56:50 +0100 Source: dawg Binary: dawg dawg-dbgsym Architecture: i386 Version: 1.2-4 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team Changed-By: Andreas Tille Description: dawg - simulate the evolution of recombinant DNA sequences Changes: dawg (1.2-4) unstable; urgency=medium . * Team upload. * Fix watch file * Standards-Version: 4.6.0 (routine-update) * Document issues with test (see upstream issue #56) Checksums-Sha1: c9e82715f641d07643ceb77597bca491f01b597e 748552 dawg-dbgsym_1.2-4_i386.deb d4cae1a466945d3e861c55d96c3c69d750c2a538 5779 dawg_1.2-4_i386.buildinfo 4bcbf2578c603b8ef8ca8da55c19ad417e1356e0 82868 dawg_1.2-4_i386.deb Checksums-Sha256: 4cfb5854de3ed102e6e0ea72548b6368fc11a7da6241ead3a7b4701fbed9cb3c 748552 dawg-dbgsym_1.2-4_i386.deb 08e3c4596b6daeff9968bd63c400fd8d47732035294efac485f8c100d6ddbc93 5779 dawg_1.2-4_i386.buildinfo fd47bef617325a4721b4aec409821a08cd11d77e9f462aa1e3508c597477fc53 82868 dawg_1.2-4_i386.deb Files: 821e78ad3fe846bfbed3c279dd8fcf7b 748552 debug optional dawg-dbgsym_1.2-4_i386.deb d22030caa393d8ef64c5feaae163cf5d 5779 science optional dawg_1.2-4_i386.buildinfo 0d1b07250a0bb5f2c1a16e8d827e9d39 82868 science optional dawg_1.2-4_i386.deb Sat May 13 07:14:17 UTC 2023 I: diffoscope 242 will be used to compare the two builds: # Profiling output for: /usr/bin/diffoscope --timeout 7200 --html /srv/reproducible-results/rbuild-debian/r-b-build.FxwaFBap/dawg_1.2-4.diffoscope.html --text /srv/reproducible-results/rbuild-debian/r-b-build.FxwaFBap/dawg_1.2-4.diffoscope.txt --json /srv/reproducible-results/rbuild-debian/r-b-build.FxwaFBap/dawg_1.2-4.diffoscope.json --profile=- /srv/reproducible-results/rbuild-debian/r-b-build.FxwaFBap/b1/dawg_1.2-4_i386.changes /srv/reproducible-results/rbuild-debian/r-b-build.FxwaFBap/b2/dawg_1.2-4_i386.changes ## command (total time: 0.000s) 0.000s 1 call cmp (internal) ## has_same_content_as (total time: 0.000s) 0.000s 1 call abc.DotChangesFile ## main (total time: 0.396s) 0.396s 2 calls outputs 0.000s 1 call cleanup ## recognizes (total time: 0.031s) 0.030s 12 calls diffoscope.comparators.binary.FilesystemFile 0.000s 10 calls abc.DotChangesFile ## specialize (total time: 0.001s) 0.001s 1 call specialize Sat May 13 07:14:18 UTC 2023 I: diffoscope 242 found no differences in the changes files, and a .buildinfo file also exists. Sat May 13 07:14:18 UTC 2023 I: dawg from bookworm built successfully and reproducibly on i386. Sat May 13 07:14:19 UTC 2023 I: Submitting .buildinfo files to external archives: Sat May 13 07:14:19 UTC 2023 I: Submitting 8.0K b1/dawg_1.2-4_i386.buildinfo.asc Sat May 13 07:14:20 UTC 2023 I: Submitting 8.0K b2/dawg_1.2-4_i386.buildinfo.asc Sat May 13 07:14:23 UTC 2023 I: Done submitting .buildinfo files to http://buildinfo.debian.net/api/submit. Sat May 13 07:14:23 UTC 2023 I: Done submitting .buildinfo files. Sat May 13 07:14:23 UTC 2023 I: Removing signed dawg_1.2-4_i386.buildinfo.asc files: removed './b1/dawg_1.2-4_i386.buildinfo.asc' removed './b2/dawg_1.2-4_i386.buildinfo.asc'