Sat Jul 29 00:30:04 UTC 2023 I: starting to build seqprep/bullseye/amd64 on jenkins on '2023-07-29 00:29' Sat Jul 29 00:30:04 UTC 2023 I: The jenkins build log is/was available at https://jenkins.debian.net/userContent/reproducible/debian/build_service/amd64_7/3739/console.log Sat Jul 29 00:30:04 UTC 2023 I: Downloading source for bullseye/seqprep=1.3.2-5 --2023-07-29 00:30:04-- http://cdn-fastly.deb.debian.org/debian/pool/main/s/seqprep/seqprep_1.3.2-5.dsc Connecting to 78.137.99.97:3128... connected. Proxy request sent, awaiting response... 200 OK Length: 2108 (2.1K) [text/prs.lines.tag] Saving to: ‘seqprep_1.3.2-5.dsc’ 0K .. 100% 200M=0s 2023-07-29 00:30:04 (200 MB/s) - ‘seqprep_1.3.2-5.dsc’ saved [2108/2108] Sat Jul 29 00:30:04 UTC 2023 I: seqprep_1.3.2-5.dsc -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA256 Format: 3.0 (quilt) Source: seqprep Binary: seqprep, seqprep-data Architecture: any all Version: 1.3.2-5 Maintainer: Debian Med Packaging Team Uploaders: Tim Booth , Andreas Tille Homepage: http://seqanswers.com/wiki/SeqPrep Standards-Version: 4.4.1 Vcs-Browser: https://salsa.debian.org/med-team/seqprep Vcs-Git: https://salsa.debian.org/med-team/seqprep.git Testsuite: autopkgtest Testsuite-Triggers: python3 Build-Depends: debhelper-compat (= 12), python3, markdown, zlib1g-dev Package-List: seqprep deb science optional arch=any seqprep-data deb science optional arch=all Checksums-Sha1: 9f533e1fd14d310ba0ccd4ef38c3abc55b8fc5fd 37177540 seqprep_1.3.2.orig.tar.gz 7a2452878a6ba5bc671f65b4449db8efa4ea8f08 10876 seqprep_1.3.2-5.debian.tar.xz Checksums-Sha256: 2b8a462a0e0a3e51f70be7730dc77b1f2bb69e74845dd0fbd2110a921c32265a 37177540 seqprep_1.3.2.orig.tar.gz 2d647e7e61cb314254e0cc00fc568e6f03120760d0b3cada27c946bb7f1d6dfb 10876 seqprep_1.3.2-5.debian.tar.xz Files: b6a4f5491dfdb0ce38bf791454151468 37177540 seqprep_1.3.2.orig.tar.gz f75fda0d0aebd9ba722baeca487ec6b4 10876 seqprep_1.3.2-5.debian.tar.xz -----BEGIN PGP SIGNATURE----- iQJFBAEBCAAvFiEE8fAHMgoDVUHwpmPKV4oElNHGRtEFAl4lhOMRHHRpbGxlQGRl Ymlhbi5vcmcACgkQV4oElNHGRtE5Cw/+IiBu2hW8AoIFTk3bAeoibOShlx/gmid0 cAlhquWkGlTEycHM0FV5H5vhdHAiBcHsnxqgehcHVGT/YIUIrGBukzHRie0cNr4o dEKMaZo4xB4fr44Vncm5xrsYje/r+2zI+77EuhWtV6drjgnUZWzLcmP6ATpiy3FD zzEofxFDeHlEM2oReAbaNDTqTAuUkXOIhx05Ls12AigcQjpOCWWQiKlk6YxUlec8 Ek7YlQQKaa0iYO+3OCG976wluFoqWS6TerTJfwdj+5QaGjNpp2tT5qEdeEM86S+r 4KMY1bGXuoOQlFh9K++wLyXnZXRA10ho0HNV2hv8AxF2huJnBZduL8m/ihFty+kU AhuHGie6uJ0EAv0p6uD3nqPLD8s474B+PolOLtVAOTlUYP8o54ACQF7IaDQv1DoB z/gWxygPgW7Qf1+TU/WJQTTwLYb0VCClffOrzf7N46jCiuc/iOni4sdNXECF4c+z RC9iYSsYGUlhpXVIXFVDXtJnd9YFdrCCjY0cqk4jn4Cw59Y/vL3weTKDkevWjLYi M5ga4DnRW6EsBV2uqxDyX3esfv/XyE1T+lnIPZkvaN5YYubif2bYlyrBUm/R3jnG yMRH/xXSFftJGanb+SFXsNw3L1WQKlWefOp0VPfjKxJCBzOs5qlX0ayo5AZPaMFX VFHk2GNvx3s= =XQep -----END PGP SIGNATURE----- Sat Jul 29 00:30:04 UTC 2023 I: Checking whether the package is not for us Sat Jul 29 00:30:04 UTC 2023 I: Starting 1st build on remote node ionos11-amd64.debian.net. Sat Jul 29 00:30:04 UTC 2023 I: Preparing to do remote build '1' on ionos11-amd64.debian.net. Sat Jul 29 00:32:26 UTC 2023 I: Deleting $TMPDIR on ionos11-amd64.debian.net. I: pbuilder: network access will be disabled during build I: Current time: Fri Jul 28 12:30:07 -12 2023 I: pbuilder-time-stamp: 1690590607 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/bullseye-reproducible-base.tgz] I: copying local configuration W: --override-config is not set; not updating apt.conf Read the manpage for details. I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [seqprep_1.3.2-5.dsc] I: copying [./seqprep_1.3.2.orig.tar.gz] I: copying [./seqprep_1.3.2-5.debian.tar.xz] I: Extracting source gpgv: unknown type of key resource 'trustedkeys.kbx' gpgv: keyblock resource '/tmp/dpkg-verify-sig.aRrnj74t/trustedkeys.kbx': General error gpgv: Signature made Sun Jan 19 22:45:55 2020 -12 gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: failed to verify signature on ./seqprep_1.3.2-5.dsc dpkg-source: info: extracting seqprep in seqprep-1.3.2 dpkg-source: info: unpacking seqprep_1.3.2.orig.tar.gz dpkg-source: info: unpacking seqprep_1.3.2-5.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying fix_unused_variable_errors.patch dpkg-source: info: applying hardening.patch dpkg-source: info: applying replace-float-with-double.patch dpkg-source: info: applying 2to3.patch I: using fakeroot in build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/3306764/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='amd64' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all,-fixfilepath parallel=15 ' DISTRIBUTION='bullseye' HOME='/root' HOST_ARCH='amd64' IFS=' ' INVOCATION_ID='1b9401a1161b464daa36881b577194a2' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='3306764' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.ALMsXBDz/pbuilderrc_NaqJ --distribution bullseye --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bullseye-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.ALMsXBDz/b1 --logfile b1/build.log seqprep_1.3.2-5.dsc' SUDO_GID='111' SUDO_UID='106' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' _='/usr/bin/systemd-run' http_proxy='http://78.137.99.97:3128' I: uname -a Linux ionos11-amd64 6.1.0-10-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.1.38-1 (2023-07-14) x86_64 GNU/Linux I: ls -l /bin total 5476 -rwxr-xr-x 1 root root 1234376 Mar 27 2022 bash -rwxr-xr-x 3 root root 38984 Jul 20 2020 bunzip2 -rwxr-xr-x 3 root root 38984 Jul 20 2020 bzcat lrwxrwxrwx 1 root root 6 Jul 20 2020 bzcmp -> bzdiff -rwxr-xr-x 1 root root 2225 Jul 20 2020 bzdiff lrwxrwxrwx 1 root root 6 Jul 20 2020 bzegrep -> bzgrep -rwxr-xr-x 1 root root 4877 Sep 4 2019 bzexe lrwxrwxrwx 1 root root 6 Jul 20 2020 bzfgrep -> bzgrep -rwxr-xr-x 1 root root 3775 Jul 20 2020 bzgrep -rwxr-xr-x 3 root root 38984 Jul 20 2020 bzip2 -rwxr-xr-x 1 root root 18424 Jul 20 2020 bzip2recover lrwxrwxrwx 1 root root 6 Jul 20 2020 bzless -> bzmore -rwxr-xr-x 1 root root 1297 Jul 20 2020 bzmore -rwxr-xr-x 1 root root 43936 Sep 23 2020 cat -rwxr-xr-x 1 root root 72672 Sep 23 2020 chgrp -rwxr-xr-x 1 root root 64448 Sep 23 2020 chmod -rwxr-xr-x 1 root root 72672 Sep 23 2020 chown -rwxr-xr-x 1 root root 151168 Sep 23 2020 cp -rwxr-xr-x 1 root root 125560 Dec 10 2020 dash -rwxr-xr-x 1 root root 113664 Sep 23 2020 date -rwxr-xr-x 1 root root 80968 Sep 23 2020 dd -rwxr-xr-x 1 root root 93936 Sep 23 2020 df -rwxr-xr-x 1 root root 147176 Sep 23 2020 dir -rwxr-xr-x 1 root root 84440 Jan 20 2022 dmesg lrwxrwxrwx 1 root root 8 Nov 6 2019 dnsdomainname -> hostname lrwxrwxrwx 1 root root 8 Nov 6 2019 domainname -> hostname -rwxr-xr-x 1 root root 39712 Sep 23 2020 echo -rwxr-xr-x 1 root root 28 Jan 24 2023 egrep -rwxr-xr-x 1 root root 39680 Sep 23 2020 false -rwxr-xr-x 1 root root 28 Jan 24 2023 fgrep -rwxr-xr-x 1 root root 69032 Jan 20 2022 findmnt -rwsr-xr-x 1 root root 34896 Feb 26 2021 fusermount -rwxr-xr-x 1 root root 203072 Jan 24 2023 grep -rwxr-xr-x 2 root root 2346 Apr 9 2022 gunzip -rwxr-xr-x 1 root root 6447 Apr 9 2022 gzexe -rwxr-xr-x 1 root root 98048 Apr 9 2022 gzip -rwxr-xr-x 1 root root 22600 Nov 6 2019 hostname -rwxr-xr-x 1 root root 72840 Sep 23 2020 ln -rwxr-xr-x 1 root root 56952 Feb 7 2020 login -rwxr-xr-x 1 root root 147176 Sep 23 2020 ls -rwxr-xr-x 1 root root 149736 Jan 20 2022 lsblk -rwxr-xr-x 1 root root 85184 Sep 23 2020 mkdir -rwxr-xr-x 1 root root 76896 Sep 23 2020 mknod -rwxr-xr-x 1 root root 48064 Sep 23 2020 mktemp -rwxr-xr-x 1 root root 59632 Jan 20 2022 more -rwsr-xr-x 1 root root 55528 Jan 20 2022 mount -rwxr-xr-x 1 root root 18664 Jan 20 2022 mountpoint -rwxr-xr-x 1 root root 147080 Sep 23 2020 mv lrwxrwxrwx 1 root root 8 Nov 6 2019 nisdomainname -> hostname lrwxrwxrwx 1 root root 14 Dec 16 2021 pidof -> /sbin/killall5 -rwxr-xr-x 1 root root 43872 Sep 23 2020 pwd lrwxrwxrwx 1 root root 4 Mar 27 2022 rbash -> bash -rwxr-xr-x 1 root root 52032 Sep 23 2020 readlink -rwxr-xr-x 1 root root 72704 Sep 23 2020 rm -rwxr-xr-x 1 root root 52032 Sep 23 2020 rmdir -rwxr-xr-x 1 root root 27472 Sep 27 2020 run-parts -rwxr-xr-x 1 root root 122224 Dec 22 2018 sed lrwxrwxrwx 1 root root 4 Jul 6 21:25 sh -> dash -rwxr-xr-x 1 root root 43808 Sep 23 2020 sleep -rwxr-xr-x 1 root root 84928 Sep 23 2020 stty -rwsr-xr-x 1 root root 71912 Jan 20 2022 su -rwxr-xr-x 1 root root 39744 Sep 23 2020 sync -rwxr-xr-x 1 root root 531928 Feb 16 2021 tar -rwxr-xr-x 1 root root 14456 Sep 27 2020 tempfile -rwxr-xr-x 1 root root 101408 Sep 23 2020 touch -rwxr-xr-x 1 root root 39680 Sep 23 2020 true -rwxr-xr-x 1 root root 14328 Feb 26 2021 ulockmgr_server -rwsr-xr-x 1 root root 35040 Jan 20 2022 umount -rwxr-xr-x 1 root root 39744 Sep 23 2020 uname -rwxr-xr-x 2 root root 2346 Apr 9 2022 uncompress -rwxr-xr-x 1 root root 147176 Sep 23 2020 vdir -rwxr-xr-x 1 root root 63744 Jan 20 2022 wdctl lrwxrwxrwx 1 root root 8 Nov 6 2019 ypdomainname -> hostname -rwxr-xr-x 1 root root 1984 Apr 9 2022 zcat -rwxr-xr-x 1 root root 1678 Apr 9 2022 zcmp -rwxr-xr-x 1 root root 5898 Apr 9 2022 zdiff -rwxr-xr-x 1 root root 29 Apr 9 2022 zegrep -rwxr-xr-x 1 root root 29 Apr 9 2022 zfgrep -rwxr-xr-x 1 root root 2081 Apr 9 2022 zforce -rwxr-xr-x 1 root root 8049 Apr 9 2022 zgrep -rwxr-xr-x 1 root root 2206 Apr 9 2022 zless -rwxr-xr-x 1 root root 1842 Apr 9 2022 zmore -rwxr-xr-x 1 root root 4577 Apr 9 2022 znew I: user script /srv/workspace/pbuilder/3306764/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: amd64 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 12), python3, markdown, zlib1g-dev dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19707 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 12); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on python3; however: Package python3 is not installed. pbuilder-satisfydepends-dummy depends on markdown; however: Package markdown is not installed. pbuilder-satisfydepends-dummy depends on zlib1g-dev; however: Package zlib1g-dev is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bsdextrautils{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} gettext{a} gettext-base{a} groff-base{a} intltool-debian{a} libarchive-zip-perl{a} libdebhelper-perl{a} libelf1{a} libexpat1{a} libfile-stripnondeterminism-perl{a} libicu67{a} libmagic-mgc{a} libmagic1{a} libmpdec3{a} libpipeline1{a} libpython3-stdlib{a} libpython3.9-minimal{a} libpython3.9-stdlib{a} libreadline8{a} libsigsegv2{a} libsub-override-perl{a} libtool{a} libuchardet0{a} libxml2{a} m4{a} man-db{a} markdown{a} media-types{a} po-debconf{a} python3{a} python3-minimal{a} python3.9{a} python3.9-minimal{a} readline-common{a} sensible-utils{a} zlib1g-dev{a} The following packages are RECOMMENDED but will NOT be installed: ca-certificates curl libarchive-cpio-perl libltdl-dev libmail-sendmail-perl lynx wget 0 packages upgraded, 45 newly installed, 0 to remove and 0 not upgraded. Need to get 24.0 MB of archives. After unpacking 89.3 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian bullseye/main amd64 bsdextrautils amd64 2.36.1-8+deb11u1 [145 kB] Get: 2 http://deb.debian.org/debian bullseye/main amd64 libuchardet0 amd64 0.0.7-1 [67.8 kB] Get: 3 http://deb.debian.org/debian bullseye/main amd64 groff-base amd64 1.22.4-6 [936 kB] Get: 4 http://deb.debian.org/debian bullseye/main amd64 libpipeline1 amd64 1.5.3-1 [34.3 kB] Get: 5 http://deb.debian.org/debian bullseye/main amd64 man-db amd64 2.9.4-2 [1354 kB] Get: 6 http://deb.debian.org/debian bullseye/main amd64 libpython3.9-minimal amd64 3.9.2-1 [801 kB] Get: 7 http://deb.debian.org/debian bullseye/main amd64 libexpat1 amd64 2.2.10-2+deb11u5 [98.2 kB] Get: 8 http://deb.debian.org/debian bullseye/main amd64 python3.9-minimal amd64 3.9.2-1 [1955 kB] Get: 9 http://deb.debian.org/debian bullseye/main amd64 python3-minimal amd64 3.9.2-3 [38.2 kB] Get: 10 http://deb.debian.org/debian bullseye/main amd64 media-types all 4.0.0 [30.3 kB] Get: 11 http://deb.debian.org/debian bullseye/main amd64 libmpdec3 amd64 2.5.1-1 [87.7 kB] Get: 12 http://deb.debian.org/debian bullseye/main amd64 readline-common all 8.1-1 [73.7 kB] Get: 13 http://deb.debian.org/debian bullseye/main amd64 libreadline8 amd64 8.1-1 [169 kB] Get: 14 http://deb.debian.org/debian bullseye/main amd64 libpython3.9-stdlib amd64 3.9.2-1 [1684 kB] Get: 15 http://deb.debian.org/debian bullseye/main amd64 python3.9 amd64 3.9.2-1 [466 kB] Get: 16 http://deb.debian.org/debian bullseye/main amd64 libpython3-stdlib amd64 3.9.2-3 [21.4 kB] Get: 17 http://deb.debian.org/debian bullseye/main amd64 python3 amd64 3.9.2-3 [37.9 kB] Get: 18 http://deb.debian.org/debian bullseye/main amd64 sensible-utils all 0.0.14 [14.8 kB] Get: 19 http://deb.debian.org/debian bullseye/main amd64 libmagic-mgc amd64 1:5.39-3 [273 kB] Get: 20 http://deb.debian.org/debian bullseye/main amd64 libmagic1 amd64 1:5.39-3 [126 kB] Get: 21 http://deb.debian.org/debian bullseye/main amd64 file amd64 1:5.39-3 [69.1 kB] Get: 22 http://deb.debian.org/debian bullseye/main amd64 gettext-base amd64 0.21-4 [175 kB] Get: 23 http://deb.debian.org/debian bullseye/main amd64 libsigsegv2 amd64 2.13-1 [34.8 kB] Get: 24 http://deb.debian.org/debian bullseye/main amd64 m4 amd64 1.4.18-5 [204 kB] Get: 25 http://deb.debian.org/debian bullseye/main amd64 autoconf all 2.69-14 [313 kB] Get: 26 http://deb.debian.org/debian bullseye/main amd64 autotools-dev all 20180224.1+nmu1 [77.1 kB] Get: 27 http://deb.debian.org/debian bullseye/main amd64 automake all 1:1.16.3-2 [814 kB] Get: 28 http://deb.debian.org/debian bullseye/main amd64 autopoint all 0.21-4 [510 kB] Get: 29 http://deb.debian.org/debian bullseye/main amd64 libdebhelper-perl all 13.3.4 [189 kB] Get: 30 http://deb.debian.org/debian bullseye/main amd64 libtool all 2.4.6-15 [513 kB] Get: 31 http://deb.debian.org/debian bullseye/main amd64 dh-autoreconf all 20 [17.1 kB] Get: 32 http://deb.debian.org/debian bullseye/main amd64 libarchive-zip-perl all 1.68-1 [104 kB] Get: 33 http://deb.debian.org/debian bullseye/main amd64 libsub-override-perl all 0.09-2 [10.2 kB] Get: 34 http://deb.debian.org/debian bullseye/main amd64 libfile-stripnondeterminism-perl all 1.12.0-1 [26.3 kB] Get: 35 http://deb.debian.org/debian bullseye/main amd64 dh-strip-nondeterminism all 1.12.0-1 [15.4 kB] Get: 36 http://deb.debian.org/debian bullseye/main amd64 libelf1 amd64 0.183-1 [165 kB] Get: 37 http://deb.debian.org/debian bullseye/main amd64 dwz amd64 0.13+20210201-1 [175 kB] Get: 38 http://deb.debian.org/debian bullseye/main amd64 libicu67 amd64 67.1-7 [8622 kB] Get: 39 http://deb.debian.org/debian bullseye/main amd64 libxml2 amd64 2.9.10+dfsg-6.7+deb11u4 [693 kB] Get: 40 http://deb.debian.org/debian bullseye/main amd64 gettext amd64 0.21-4 [1311 kB] Get: 41 http://deb.debian.org/debian bullseye/main amd64 intltool-debian all 0.35.0+20060710.5 [26.8 kB] Get: 42 http://deb.debian.org/debian bullseye/main amd64 po-debconf all 1.0.21+nmu1 [248 kB] Get: 43 http://deb.debian.org/debian bullseye/main amd64 debhelper all 13.3.4 [1049 kB] Get: 44 http://deb.debian.org/debian bullseye/main amd64 markdown all 1.0.1-10.1 [17.5 kB] Get: 45 http://deb.debian.org/debian bullseye/main amd64 zlib1g-dev amd64 1:1.2.11.dfsg-2+deb11u2 [191 kB] Fetched 24.0 MB in 0s (49.8 MB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package bsdextrautils. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19707 files and directories currently installed.) Preparing to unpack .../0-bsdextrautils_2.36.1-8+deb11u1_amd64.deb ... Unpacking bsdextrautils (2.36.1-8+deb11u1) ... Selecting previously unselected package libuchardet0:amd64. Preparing to unpack .../1-libuchardet0_0.0.7-1_amd64.deb ... Unpacking libuchardet0:amd64 (0.0.7-1) ... Selecting previously unselected package groff-base. Preparing to unpack .../2-groff-base_1.22.4-6_amd64.deb ... Unpacking groff-base (1.22.4-6) ... Selecting previously unselected package libpipeline1:amd64. Preparing to unpack .../3-libpipeline1_1.5.3-1_amd64.deb ... Unpacking libpipeline1:amd64 (1.5.3-1) ... Selecting previously unselected package man-db. Preparing to unpack .../4-man-db_2.9.4-2_amd64.deb ... Unpacking man-db (2.9.4-2) ... Selecting previously unselected package libpython3.9-minimal:amd64. Preparing to unpack .../5-libpython3.9-minimal_3.9.2-1_amd64.deb ... Unpacking libpython3.9-minimal:amd64 (3.9.2-1) ... Selecting previously unselected package libexpat1:amd64. Preparing to unpack .../6-libexpat1_2.2.10-2+deb11u5_amd64.deb ... Unpacking libexpat1:amd64 (2.2.10-2+deb11u5) ... Selecting previously unselected package python3.9-minimal. Preparing to unpack .../7-python3.9-minimal_3.9.2-1_amd64.deb ... Unpacking python3.9-minimal (3.9.2-1) ... Setting up libpython3.9-minimal:amd64 (3.9.2-1) ... Setting up libexpat1:amd64 (2.2.10-2+deb11u5) ... Setting up python3.9-minimal (3.9.2-1) ... Selecting previously unselected package python3-minimal. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20574 files and directories currently installed.) Preparing to unpack .../0-python3-minimal_3.9.2-3_amd64.deb ... Unpacking python3-minimal (3.9.2-3) ... Selecting previously unselected package media-types. Preparing to unpack .../1-media-types_4.0.0_all.deb ... Unpacking media-types (4.0.0) ... Selecting previously unselected package libmpdec3:amd64. Preparing to unpack .../2-libmpdec3_2.5.1-1_amd64.deb ... Unpacking libmpdec3:amd64 (2.5.1-1) ... Selecting previously unselected package readline-common. Preparing to unpack .../3-readline-common_8.1-1_all.deb ... Unpacking readline-common (8.1-1) ... Selecting previously unselected package libreadline8:amd64. Preparing to unpack .../4-libreadline8_8.1-1_amd64.deb ... Unpacking libreadline8:amd64 (8.1-1) ... Selecting previously unselected package libpython3.9-stdlib:amd64. Preparing to unpack .../5-libpython3.9-stdlib_3.9.2-1_amd64.deb ... Unpacking libpython3.9-stdlib:amd64 (3.9.2-1) ... Selecting previously unselected package python3.9. Preparing to unpack .../6-python3.9_3.9.2-1_amd64.deb ... Unpacking python3.9 (3.9.2-1) ... Selecting previously unselected package libpython3-stdlib:amd64. Preparing to unpack .../7-libpython3-stdlib_3.9.2-3_amd64.deb ... Unpacking libpython3-stdlib:amd64 (3.9.2-3) ... Setting up python3-minimal (3.9.2-3) ... Selecting previously unselected package python3. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20995 files and directories currently installed.) Preparing to unpack .../00-python3_3.9.2-3_amd64.deb ... Unpacking python3 (3.9.2-3) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../01-sensible-utils_0.0.14_all.deb ... Unpacking sensible-utils (0.0.14) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../02-libmagic-mgc_1%3a5.39-3_amd64.deb ... Unpacking libmagic-mgc (1:5.39-3) ... Selecting previously unselected package libmagic1:amd64. Preparing to unpack .../03-libmagic1_1%3a5.39-3_amd64.deb ... Unpacking libmagic1:amd64 (1:5.39-3) ... Selecting previously unselected package file. Preparing to unpack .../04-file_1%3a5.39-3_amd64.deb ... Unpacking file (1:5.39-3) ... Selecting previously unselected package gettext-base. Preparing to unpack .../05-gettext-base_0.21-4_amd64.deb ... Unpacking gettext-base (0.21-4) ... Selecting previously unselected package libsigsegv2:amd64. Preparing to unpack .../06-libsigsegv2_2.13-1_amd64.deb ... Unpacking libsigsegv2:amd64 (2.13-1) ... Selecting previously unselected package m4. Preparing to unpack .../07-m4_1.4.18-5_amd64.deb ... Unpacking m4 (1.4.18-5) ... Selecting previously unselected package autoconf. Preparing to unpack .../08-autoconf_2.69-14_all.deb ... Unpacking autoconf (2.69-14) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../09-autotools-dev_20180224.1+nmu1_all.deb ... Unpacking autotools-dev (20180224.1+nmu1) ... Selecting previously unselected package automake. Preparing to unpack .../10-automake_1%3a1.16.3-2_all.deb ... Unpacking automake (1:1.16.3-2) ... Selecting previously unselected package autopoint. Preparing to unpack .../11-autopoint_0.21-4_all.deb ... Unpacking autopoint (0.21-4) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../12-libdebhelper-perl_13.3.4_all.deb ... Unpacking libdebhelper-perl (13.3.4) ... Selecting previously unselected package libtool. Preparing to unpack .../13-libtool_2.4.6-15_all.deb ... Unpacking libtool (2.4.6-15) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../14-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../15-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libsub-override-perl. Preparing to unpack .../16-libsub-override-perl_0.09-2_all.deb ... Unpacking libsub-override-perl (0.09-2) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../17-libfile-stripnondeterminism-perl_1.12.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.12.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../18-dh-strip-nondeterminism_1.12.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.12.0-1) ... Selecting previously unselected package libelf1:amd64. Preparing to unpack .../19-libelf1_0.183-1_amd64.deb ... Unpacking libelf1:amd64 (0.183-1) ... Selecting previously unselected package dwz. Preparing to unpack .../20-dwz_0.13+20210201-1_amd64.deb ... Unpacking dwz (0.13+20210201-1) ... Selecting previously unselected package libicu67:amd64. Preparing to unpack .../21-libicu67_67.1-7_amd64.deb ... Unpacking libicu67:amd64 (67.1-7) ... Selecting previously unselected package libxml2:amd64. Preparing to unpack .../22-libxml2_2.9.10+dfsg-6.7+deb11u4_amd64.deb ... Unpacking libxml2:amd64 (2.9.10+dfsg-6.7+deb11u4) ... Selecting previously unselected package gettext. Preparing to unpack .../23-gettext_0.21-4_amd64.deb ... Unpacking gettext (0.21-4) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../24-intltool-debian_0.35.0+20060710.5_all.deb ... Unpacking intltool-debian (0.35.0+20060710.5) ... Selecting previously unselected package po-debconf. Preparing to unpack .../25-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../26-debhelper_13.3.4_all.deb ... Unpacking debhelper (13.3.4) ... Selecting previously unselected package markdown. Preparing to unpack .../27-markdown_1.0.1-10.1_all.deb ... Unpacking markdown (1.0.1-10.1) ... Selecting previously unselected package zlib1g-dev:amd64. Preparing to unpack .../28-zlib1g-dev_1%3a1.2.11.dfsg-2+deb11u2_amd64.deb ... Unpacking zlib1g-dev:amd64 (1:1.2.11.dfsg-2+deb11u2) ... Setting up media-types (4.0.0) ... Setting up libpipeline1:amd64 (1.5.3-1) ... Setting up bsdextrautils (2.36.1-8+deb11u1) ... update-alternatives: using /usr/bin/write.ul to provide /usr/bin/write (write) in auto mode Setting up libicu67:amd64 (67.1-7) ... Setting up libmagic-mgc (1:5.39-3) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libdebhelper-perl (13.3.4) ... Setting up libmagic1:amd64 (1:5.39-3) ... Setting up gettext-base (0.21-4) ... Setting up file (1:5.39-3) ... Setting up autotools-dev (20180224.1+nmu1) ... Setting up libsigsegv2:amd64 (2.13-1) ... Setting up autopoint (0.21-4) ... Setting up zlib1g-dev:amd64 (1:1.2.11.dfsg-2+deb11u2) ... Setting up sensible-utils (0.0.14) ... Setting up libuchardet0:amd64 (0.0.7-1) ... Setting up libmpdec3:amd64 (2.5.1-1) ... Setting up libsub-override-perl (0.09-2) ... Setting up libelf1:amd64 (0.183-1) ... Setting up readline-common (8.1-1) ... Setting up libxml2:amd64 (2.9.10+dfsg-6.7+deb11u4) ... Setting up markdown (1.0.1-10.1) ... Setting up libfile-stripnondeterminism-perl (1.12.0-1) ... Setting up gettext (0.21-4) ... Setting up libtool (2.4.6-15) ... Setting up libreadline8:amd64 (8.1-1) ... Setting up m4 (1.4.18-5) ... Setting up intltool-debian (0.35.0+20060710.5) ... Setting up autoconf (2.69-14) ... Setting up dh-strip-nondeterminism (1.12.0-1) ... Setting up dwz (0.13+20210201-1) ... Setting up groff-base (1.22.4-6) ... Setting up libpython3.9-stdlib:amd64 (3.9.2-1) ... Setting up libpython3-stdlib:amd64 (3.9.2-3) ... Setting up automake (1:1.16.3-2) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up po-debconf (1.0.21+nmu1) ... Setting up man-db (2.9.4-2) ... Not building database; man-db/auto-update is not 'true'. Setting up dh-autoreconf (20) ... Setting up python3.9 (3.9.2-1) ... Setting up debhelper (13.3.4) ... Setting up python3 (3.9.2-3) ... Processing triggers for libc-bin (2.31-13+deb11u6) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps Reading package lists... Building dependency tree... Reading state information... fakeroot is already the newest version (1.25.3-1.1). 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. I: Building the package I: Running cd /build/seqprep-1.3.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../seqprep_1.3.2-5_source.changes dpkg-buildpackage: info: source package seqprep dpkg-buildpackage: info: source version 1.3.2-5 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Andreas Tille dpkg-source --before-build . dpkg-buildpackage: info: host architecture amd64 fakeroot debian/rules clean dh clean dh_auto_clean make -j15 clean make[1]: Entering directory '/build/seqprep-1.3.2' rm -f SeqPrep.o utils.o stdaln.o SeqPrep make[1]: Leaving directory '/build/seqprep-1.3.2' debian/rules override_dh_clean make[1]: Entering directory '/build/seqprep-1.3.2' dh_clean rm -f seqprep rm -f README.html make[1]: Leaving directory '/build/seqprep-1.3.2' debian/rules build dh build dh_update_autotools_config dh_autoreconf dh_auto_configure debian/rules override_dh_auto_build make[1]: Entering directory '/build/seqprep-1.3.2' dh_auto_build make -j15 "INSTALL=install --strip-program=true" make[2]: Entering directory '/build/seqprep-1.3.2' cc -g -O2 -fdebug-prefix-map=/build/seqprep-1.3.2=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 SeqPrep.c -o SeqPrep.o cc -g -O2 -fdebug-prefix-map=/build/seqprep-1.3.2=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 utils.c -o utils.o cc -g -O2 -fdebug-prefix-map=/build/seqprep-1.3.2=. -fstack-protector-strong -Wformat -Werror=format-security -std=gnu90 -c -Wall -O0 -g -std=c99 stdaln.c -o stdaln.o SeqPrep.c: In function 'main': SeqPrep.c:166:15: warning: implicit declaration of function 'getopt' [-Wimplicit-function-declaration] 166 | while( (ich=getopt( argc, argv, "f:r:1:2:3:4:q:A:s:y:B:O:E:x:M:N:L:o:m:b:w:W:p:P:X:Q:t:e:Z:n:S6ghz" )) != -1 ) { | ^~~~~~ cc SeqPrep.o utils.o stdaln.o -Wl,-z,relro -Wl,-z,now -lz -lm -o SeqPrep make[2]: Leaving directory '/build/seqprep-1.3.2' cp SeqPrep seqprep markdown README.md > README.html make[1]: Leaving directory '/build/seqprep-1.3.2' debian/rules override_dh_auto_test make[1]: Entering directory '/build/seqprep-1.3.2' # This checks that the tests run and produce byte-identical results. cd Test && mkdir -p out info && \ bash -xc 'gzcat(){ zcat "$@" ; } ; . RUNTEST.sh' + . RUNTEST.sh ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_merged_1.fastq.gz -2 ./out/pe_bad_contam_merged_2.fastq.gz -s ./out/pe_bad_contam_merged_s.fastq.gz -E ./info/alignments_merged.txt.gz Pairs Processed: 0 Pairs Merged: 14314 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.408093 ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 ./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz Pairs Processed: 0 Pairs Merged: 0 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.386306 ++ prog=gzcat ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ python3 seqlens.py ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz ++ zcat ./out/pe_bad_contam_merged_1.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_2.fastq.gz ++ zcat ./out/pe_bad_contam_merged_2.fastq.gz ++ gzcat ./out/pe_bad_contam_merged_s.fastq.gz ++ zcat ./out/pe_bad_contam_merged_s.fastq.gz ++ python3 seqlens.py [ `cat Test/info/pe_*.txt | md5sum | cut -b -10` = 8bc8e0787e ] # remove output dirs right after testing to make sure the files # will not be included in the data package rm -rf Test/info Test/out make[1]: Leaving directory '/build/seqprep-1.3.2' create-stamp debian/debhelper-build-stamp fakeroot debian/rules binary dh binary dh_testroot dh_prep dh_auto_install make -j15 install DESTDIR=/build/seqprep-1.3.2/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/seqprep-1.3.2' cp SeqPrep /nonexistent/first-build/bin cp: cannot create regular file '/nonexistent/first-build/bin': No such file or directory make[1]: [Makefile:15: install] Error 1 (ignored) make[1]: Leaving directory '/build/seqprep-1.3.2' debian/rules override_dh_install-indep make[1]: Entering directory '/build/seqprep-1.3.2' dh_install sed -i 's#../SeqPrep#/usr/bin/seqprep#' /build/seqprep-1.3.2/debian/seqprep-data/usr/share/doc/seqprep/examples/RUNTEST.sh make[1]: Leaving directory '/build/seqprep-1.3.2' dh_install -Nseqprep-data dh_installdocs dh_installchangelogs dh_installman dh_perl dh_link dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_dwz dh_strip dh_makeshlibs dh_shlibdeps dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'seqprep-data' in '../seqprep-data_1.3.2-5_all.deb'. dpkg-deb: building package 'seqprep-dbgsym' in '../seqprep-dbgsym_1.3.2-5_amd64.deb'. dpkg-deb: building package 'seqprep' in '../seqprep_1.3.2-5_amd64.deb'. dpkg-genbuildinfo --build=binary dpkg-genchanges --build=binary >../seqprep_1.3.2-5_amd64.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/3306764 and its subdirectories I: Current time: Fri Jul 28 12:32:25 -12 2023 I: pbuilder-time-stamp: 1690590745 Sat Jul 29 00:32:27 UTC 2023 I: 1st build successful. Starting 2nd build on remote node ionos15-amd64.debian.net. Sat Jul 29 00:32:27 UTC 2023 I: Preparing to do remote build '2' on ionos15-amd64.debian.net. Sat Jul 29 00:34:27 UTC 2023 I: Deleting $TMPDIR on ionos15-amd64.debian.net. Sat Jul 29 00:34:27 UTC 2023 I: seqprep_1.3.2-5_amd64.changes: Format: 1.8 Date: Mon, 20 Jan 2020 11:31:59 +0100 Source: seqprep Binary: seqprep seqprep-data seqprep-dbgsym Architecture: all amd64 Version: 1.3.2-5 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team Changed-By: Andreas Tille Description: seqprep - stripping adaptors and/or merging paired reads of DNA sequences w seqprep-data - example data set for seqprep - only used for testing Closes: 938467 Changes: seqprep (1.3.2-5) unstable; urgency=medium . * Test-Depends: s/python/python3/ Closes: #938467 * Set upstream metadata fields: Bug-Submit. Checksums-Sha1: f9958eb47ae2e29340f30fd9a4b3cce969e94f8b 35860104 seqprep-data_1.3.2-5_all.deb 3d193b0d4ee2ee128f7ef9e3a90a43964c1255e5 18264 seqprep-dbgsym_1.3.2-5_amd64.deb f2890cfa7e67bcd669dc288633c0732ab38ddf2e 6013 seqprep_1.3.2-5_amd64.buildinfo a8e08b5b7e6455db8b43a8376d5cc74d032f1144 28564 seqprep_1.3.2-5_amd64.deb Checksums-Sha256: 8fd3a1795235bf1230a762f6fbdb28f0d5778b8a96cb9e613235714ad035a5eb 35860104 seqprep-data_1.3.2-5_all.deb 3795fd10dc878290e82f59febef9ac78d36e780f137e0926a1c76e20923ebdf9 18264 seqprep-dbgsym_1.3.2-5_amd64.deb 758c7dbbd5d66e1104198aaabe91ce317ea87beae061899ea3a9f7475c2f5507 6013 seqprep_1.3.2-5_amd64.buildinfo cb315f0631ce95d370c9998fb3a1f42c32ca2f9de78e81740558c1c5f59f29bc 28564 seqprep_1.3.2-5_amd64.deb Files: e1d40e2e4b9a193e4a338d46c8b4e8ee 35860104 science optional seqprep-data_1.3.2-5_all.deb dc1b6d38c784030573fe9813ef99bcd9 18264 debug optional seqprep-dbgsym_1.3.2-5_amd64.deb 1d857dd1c45654b5955a8a555be1c769 6013 science optional seqprep_1.3.2-5_amd64.buildinfo def6f6a078d5c9d10eca03d541b9cfc4 28564 science optional seqprep_1.3.2-5_amd64.deb Sat Jul 29 00:34:28 UTC 2023 I: diffoscope 243 will be used to compare the two builds: # Profiling output for: /usr/bin/diffoscope --timeout 7200 --html /srv/reproducible-results/rbuild-debian/r-b-build.ALMsXBDz/seqprep_1.3.2-5.diffoscope.html --text /srv/reproducible-results/rbuild-debian/r-b-build.ALMsXBDz/seqprep_1.3.2-5.diffoscope.txt --json /srv/reproducible-results/rbuild-debian/r-b-build.ALMsXBDz/seqprep_1.3.2-5.diffoscope.json --profile=- /srv/reproducible-results/rbuild-debian/r-b-build.ALMsXBDz/b1/seqprep_1.3.2-5_amd64.changes /srv/reproducible-results/rbuild-debian/r-b-build.ALMsXBDz/b2/seqprep_1.3.2-5_amd64.changes ## command (total time: 0.000s) 0.000s 1 call cmp (internal) ## has_same_content_as (total time: 0.000s) 0.000s 1 call abc.DotChangesFile ## main (total time: 0.532s) 0.532s 2 calls outputs 0.000s 1 call cleanup ## recognizes (total time: 0.309s) 0.308s 12 calls diffoscope.comparators.binary.FilesystemFile 0.000s 10 calls abc.DotChangesFile ## specialize (total time: 0.000s) 0.000s 1 call specialize Sat Jul 29 00:34:29 UTC 2023 I: diffoscope 243 found no differences in the changes files, and a .buildinfo file also exists. Sat Jul 29 00:34:29 UTC 2023 I: seqprep from bullseye built successfully and reproducibly on amd64. Sat Jul 29 00:34:35 UTC 2023 I: Submitting .buildinfo files to external archives: Sat Jul 29 00:34:35 UTC 2023 I: Submitting 8.0K b1/seqprep_1.3.2-5_amd64.buildinfo.asc Sat Jul 29 00:34:36 UTC 2023 I: Submitting 8.0K b2/seqprep_1.3.2-5_amd64.buildinfo.asc Sat Jul 29 00:34:37 UTC 2023 I: Done submitting .buildinfo files to http://buildinfo.debian.net/api/submit. Sat Jul 29 00:34:37 UTC 2023 I: Done submitting .buildinfo files. Sat Jul 29 00:34:37 UTC 2023 I: Removing signed seqprep_1.3.2-5_amd64.buildinfo.asc files: removed './b1/seqprep_1.3.2-5_amd64.buildinfo.asc' removed './b2/seqprep_1.3.2-5_amd64.buildinfo.asc'