Wed Jul 7 22:34:25 UTC 2021 I: starting to build dawg/bullseye/arm64 on jenkins on '2021-07-07 22:34' Wed Jul 7 22:34:25 UTC 2021 I: The jenkins build log is/was available at https://jenkins.debian.net/userContent/reproducible/debian/build_service/arm64_29/7783/console.log Wed Jul 7 22:34:25 UTC 2021 I: Downloading source for bullseye/dawg=1.2-3 --2021-07-07 22:34:25-- http://cdn-fastly.deb.debian.org/debian/pool/main/d/dawg/dawg_1.2-3.dsc Connecting to 78.137.99.97:3128... connected. Proxy request sent, awaiting response... 200 OK Length: 1928 (1.9K) Saving to: ‘dawg_1.2-3.dsc’ 0K . 100% 134M=0s 2021-07-07 22:34:25 (134 MB/s) - ‘dawg_1.2-3.dsc’ saved [1928/1928] Wed Jul 7 22:34:26 UTC 2021 I: dawg_1.2-3.dsc -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA512 Format: 3.0 (quilt) Source: dawg Binary: dawg Architecture: any Version: 1.2-3 Maintainer: Debian Med Packaging Team Uploaders: Kevin Murray Homepage: https://github.com/reedacartwright/dawg Standards-Version: 4.5.0 Vcs-Browser: https://salsa.debian.org/med-team/dawg Vcs-Git: https://salsa.debian.org/med-team/dawg.git Testsuite: autopkgtest Build-Depends: debhelper-compat (= 13), cmake, bison, flex Package-List: dawg deb science optional arch=any Checksums-Sha1: f2a15e75bc7ccaa180f92e8ec14bf3b5f936b678 180312 dawg_1.2.orig.tar.gz f87be7d2f1277746e639cb9883c223761f229f8c 7748 dawg_1.2-3.debian.tar.xz Checksums-Sha256: 0034d77309e538b34a395916326818a1a0d37cad789819178a905daabb41c9fe 180312 dawg_1.2.orig.tar.gz 3a0b5b47abf65c566f517669096cd05eaa461fcb6b5a6d3b9a2042508876db51 7748 dawg_1.2-3.debian.tar.xz Files: 369a26a5c7a905acefb566cfcb4270b9 180312 dawg_1.2.orig.tar.gz cd2ffb0f66ecdf75366f242fc9db9546 7748 dawg_1.2-3.debian.tar.xz -----BEGIN PGP SIGNATURE----- iQJFBAEBCgAvFiEE8fAHMgoDVUHwpmPKV4oElNHGRtEFAl+yRsoRHHRpbGxlQGRl Ymlhbi5vcmcACgkQV4oElNHGRtELrA//a5IF33zdbZv8QWsctaM2oAjoTOy+mW/3 ols3eaIg2mRe1QciCumOmLOAlsJAfbhxyluzRxgU0tdPGtv1I+pNgxCuQ7i4BZlE flMKIJ/qKXYf8lCh27WF2edubwtaX8XbHSP7fm2GnP1jgJhJijtQBoE0BR8GoSk7 E5iAPlaZ5LmiW0/EA5qFKvx7j3+t5cvpSQrEPvHj7KDWCjNXRNjwWIL9IzkG0ofN V76wrnf2vSZFWR1ZJc1/Qxb/J6tG+dRbHBHtzffiwbfPuSkuOyfovYdyLF66+ADv /4HdcQXHQVnhNYyPvyhNInFlFVn5ZNMts3802utYXCANraS7TDjHzq94Oa+WS6B0 EMRyOVDfijDASFxfjWv4Rch7yULiIMqNbBmcea+to8X3sb2+rXFHhNXcfMNev50y Q4GD4F1Wkxu0X237bJrYiIV1AtNtnS/lsQNi11+8dkoJvmUf+WM1aev7JfQXsFe7 mmDRDox3gE7rusgmRguNkuD/XnhHDlyuzpx/CKurDibICKcd0iPYLZQxFEFixMZ9 MwrhJqavdBQ1Sw/bBetjBkMLSsQqpNQmi6qpgxJl1P98vM9Q/rQo8ee+ZzkdBH8F 28w7FtIaFQWNoeDxbZyxARTtH+APcyoINNF8/NcRfanH18T1a+8kEWJb1g8EON5V TxPn3yOUaJc= =28Nt -----END PGP SIGNATURE----- Wed Jul 7 22:34:26 UTC 2021 I: Checking whether the package is not for us Wed Jul 7 22:34:26 UTC 2021 I: Starting 1st build on remote node codethink16-arm64.debian.net. Wed Jul 7 22:34:26 UTC 2021 I: Preparing to do remote build '1' on codethink16-arm64.debian.net. Wed Jul 7 22:35:25 UTC 2021 I: Deleting $TMPDIR on codethink16-arm64.debian.net. I: pbuilder: network access will be disabled during build I: Current time: Wed Jul 7 10:34:31 -12 2021 I: pbuilder-time-stamp: 1625697271 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/bullseye-reproducible-base.tgz] I: copying local configuration I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [dawg_1.2-3.dsc] I: copying [./dawg_1.2.orig.tar.gz] I: copying [./dawg_1.2-3.debian.tar.xz] I: Extracting source gpgv: unknown type of key resource 'trustedkeys.kbx' gpgv: keyblock resource '/tmp/dpkg-verify-sig.Cbl6EJwW/trustedkeys.kbx': General error gpgv: Signature made Sun Nov 15 21:30:50 2020 -12 gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: failed to verify signature on ./dawg_1.2-3.dsc dpkg-source: info: extracting dawg in dawg-1.2 dpkg-source: info: unpacking dawg_1.2.orig.tar.gz dpkg-source: info: unpacking dawg_1.2-3.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying 0001-Add-missing-include-of-cstring.patch dpkg-source: info: applying 0003-Don-t-override-install-directories.patch dpkg-source: info: applying 0004-Fix-typo-in-help-text.patch dpkg-source: info: applying 0005-Remove-Encoding-add-Keywords-to-dawg.desktop.patch dpkg-source: info: applying 0006-relative-path-in-test-script.patch I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/25778/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='arm64' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all,-fixfilepath parallel=8' DISTRIBUTION='' HOME='/var/lib/jenkins' HOST_ARCH='arm64' IFS=' ' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='25778' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/tmp.ztGLzrhpun/pbuilderrc_cphS --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bullseye-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/tmp.ztGLzrhpun/b1 --logfile b1/build.log dawg_1.2-3.dsc' SUDO_GID='117' SUDO_UID='110' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' USERNAME='root' _='/usr/bin/systemd-run' http_proxy='http://192.168.101.16:3128' I: uname -a Linux codethink16-arm64 4.15.0-147-generic #151-Ubuntu SMP Fri Jun 18 19:18:37 UTC 2021 aarch64 GNU/Linux I: ls -l /bin total 5252 -rwxr-xr-x 1 root root 1282512 Jun 21 14:26 bash -rwxr-xr-x 3 root root 34808 Jul 20 2020 bunzip2 -rwxr-xr-x 3 root root 34808 Jul 20 2020 bzcat lrwxrwxrwx 1 root root 6 Jul 20 2020 bzcmp -> bzdiff -rwxr-xr-x 1 root root 2225 Jul 20 2020 bzdiff lrwxrwxrwx 1 root root 6 Jul 20 2020 bzegrep -> bzgrep -rwxr-xr-x 1 root root 4877 Sep 4 2019 bzexe lrwxrwxrwx 1 root root 6 Jul 20 2020 bzfgrep -> bzgrep -rwxr-xr-x 1 root root 3775 Jul 20 2020 bzgrep -rwxr-xr-x 3 root root 34808 Jul 20 2020 bzip2 -rwxr-xr-x 1 root root 14264 Jul 20 2020 bzip2recover lrwxrwxrwx 1 root root 6 Jul 20 2020 bzless -> bzmore -rwxr-xr-x 1 root root 1297 Jul 20 2020 bzmore -rwxr-xr-x 1 root root 39832 Sep 22 2020 cat -rwxr-xr-x 1 root root 64512 Sep 22 2020 chgrp -rwxr-xr-x 1 root root 60368 Sep 22 2020 chmod -rwxr-xr-x 1 root root 64528 Sep 22 2020 chown -rwxr-xr-x 1 root root 138896 Sep 22 2020 cp -rwxr-xr-x 1 root root 129544 Dec 10 2020 dash -rwxr-xr-x 1 root root 101384 Sep 22 2020 date -rwxr-xr-x 1 root root 80984 Sep 22 2020 dd -rwxr-xr-x 1 root root 89824 Sep 22 2020 df -rwxr-xr-x 1 root root 143088 Sep 22 2020 dir -rwxr-xr-x 1 root root 76152 Feb 7 02:38 dmesg lrwxrwxrwx 1 root root 8 Nov 6 2019 dnsdomainname -> hostname lrwxrwxrwx 1 root root 8 Nov 6 2019 domainname -> hostname -rwxr-xr-x 1 root root 35632 Sep 22 2020 echo -rwxr-xr-x 1 root root 28 Nov 9 2020 egrep -rwxr-xr-x 1 root root 31512 Sep 22 2020 false -rwxr-xr-x 1 root root 28 Nov 9 2020 fgrep -rwxr-xr-x 1 root root 64856 Feb 7 02:38 findmnt -rwsr-xr-x 1 root root 34824 Feb 26 04:12 fusermount -rwxr-xr-x 1 root root 178400 Nov 9 2020 grep -rwxr-xr-x 2 root root 2346 Mar 2 11:30 gunzip -rwxr-xr-x 1 root root 6376 Mar 2 11:30 gzexe -rwxr-xr-x 1 root root 93744 Mar 2 11:30 gzip -rwxr-xr-x 1 root root 18440 Nov 6 2019 hostname -rwxr-xr-x 1 root root 68720 Sep 22 2020 ln -rwxr-xr-x 1 root root 52720 Feb 7 2020 login -rwxr-xr-x 1 root root 143088 Sep 22 2020 ls -rwxr-xr-x 1 root root 161960 Feb 7 02:38 lsblk -rwxr-xr-x 1 root root 85200 Sep 22 2020 mkdir -rwxr-xr-x 1 root root 68744 Sep 22 2020 mknod -rwxr-xr-x 1 root root 43976 Sep 22 2020 mktemp -rwxr-xr-x 1 root root 51368 Feb 7 02:38 more -rwsr-xr-x 1 root root 51360 Feb 7 02:38 mount -rwxr-xr-x 1 root root 14496 Feb 7 02:38 mountpoint -rwxr-xr-x 1 root root 134808 Sep 22 2020 mv lrwxrwxrwx 1 root root 8 Nov 6 2019 nisdomainname -> hostname lrwxrwxrwx 1 root root 14 Apr 18 03:38 pidof -> /sbin/killall5 -rwxr-xr-x 1 root root 35720 Sep 22 2020 pwd lrwxrwxrwx 1 root root 4 Jun 21 14:26 rbash -> bash -rwxr-xr-x 1 root root 43872 Sep 22 2020 readlink -rwxr-xr-x 1 root root 68592 Sep 22 2020 rm -rwxr-xr-x 1 root root 43880 Sep 22 2020 rmdir -rwxr-xr-x 1 root root 19208 Sep 27 2020 run-parts -rwxr-xr-x 1 root root 114016 Dec 22 2018 sed lrwxrwxrwx 1 root root 4 Jul 5 21:25 sh -> dash -rwxr-xr-x 1 root root 35656 Sep 22 2020 sleep -rwxr-xr-x 1 root root 72640 Sep 22 2020 stty -rwsr-xr-x 1 root root 67776 Feb 7 02:38 su -rwxr-xr-x 1 root root 35672 Sep 22 2020 sync -rwxr-xr-x 1 root root 535768 Feb 16 21:55 tar -rwxr-xr-x 1 root root 10568 Sep 27 2020 tempfile -rwxr-xr-x 1 root root 89120 Sep 22 2020 touch -rwxr-xr-x 1 root root 31512 Sep 22 2020 true -rwxr-xr-x 1 root root 14264 Feb 26 04:12 ulockmgr_server -rwsr-xr-x 1 root root 30880 Feb 7 02:38 umount -rwxr-xr-x 1 root root 35640 Sep 22 2020 uname -rwxr-xr-x 2 root root 2346 Mar 2 11:30 uncompress -rwxr-xr-x 1 root root 143088 Sep 22 2020 vdir -rwxr-xr-x 1 root root 59584 Feb 7 02:38 wdctl lrwxrwxrwx 1 root root 8 Nov 6 2019 ypdomainname -> hostname -rwxr-xr-x 1 root root 1984 Mar 2 11:30 zcat -rwxr-xr-x 1 root root 1678 Mar 2 11:30 zcmp -rwxr-xr-x 1 root root 5880 Mar 2 11:30 zdiff -rwxr-xr-x 1 root root 29 Mar 2 11:30 zegrep -rwxr-xr-x 1 root root 29 Mar 2 11:30 zfgrep -rwxr-xr-x 1 root root 2081 Mar 2 11:30 zforce -rwxr-xr-x 1 root root 7585 Mar 2 11:30 zgrep -rwxr-xr-x 1 root root 2206 Mar 2 11:30 zless -rwxr-xr-x 1 root root 1842 Mar 2 11:30 zmore -rwxr-xr-x 1 root root 4553 Mar 2 11:30 znew I: user script /srv/workspace/pbuilder/25778/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: arm64 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), cmake, bison, flex dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19646 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on cmake; however: Package cmake is not installed. pbuilder-satisfydepends-dummy depends on bison; however: Package bison is not installed. pbuilder-satisfydepends-dummy depends on flex; however: Package flex is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bison{a} bsdextrautils{a} cmake{a} cmake-data{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} flex{a} gettext{a} gettext-base{a} groff-base{a} intltool-debian{a} libarchive-zip-perl{a} libarchive13{a} libbrotli1{a} libcurl4{a} libdebhelper-perl{a} libelf1{a} libexpat1{a} libfile-stripnondeterminism-perl{a} libicu67{a} libjsoncpp24{a} libldap-2.4-2{a} libmagic-mgc{a} libmagic1{a} libncurses6{a} libnghttp2-14{a} libpipeline1{a} libprocps8{a} libpsl5{a} librhash0{a} librtmp1{a} libsasl2-2{a} libsasl2-modules-db{a} libsigsegv2{a} libssh2-1{a} libsub-override-perl{a} libtool{a} libuchardet0{a} libuv1{a} libxml2{a} m4{a} man-db{a} po-debconf{a} procps{a} sensible-utils{a} The following packages are RECOMMENDED but will NOT be installed: ca-certificates curl libarchive-cpio-perl libfl-dev libgpm2 libldap-common libltdl-dev libmail-sendmail-perl libsasl2-modules lynx psmisc publicsuffix wget 0 packages upgraded, 52 newly installed, 0 to remove and 0 not upgraded. Need to get 27.6 MB of archives. After unpacking 108 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian bullseye/main arm64 bsdextrautils arm64 2.36.1-7 [141 kB] Get: 2 http://deb.debian.org/debian bullseye/main arm64 libuchardet0 arm64 0.0.7-1 [67.9 kB] Get: 3 http://deb.debian.org/debian bullseye/main arm64 groff-base arm64 1.22.4-6 [883 kB] Get: 4 http://deb.debian.org/debian bullseye/main arm64 libpipeline1 arm64 1.5.3-1 [33.0 kB] Get: 5 http://deb.debian.org/debian bullseye/main arm64 man-db arm64 2.9.4-2 [1336 kB] Get: 6 http://deb.debian.org/debian bullseye/main arm64 libsigsegv2 arm64 2.13-1 [34.7 kB] Get: 7 http://deb.debian.org/debian bullseye/main arm64 m4 arm64 1.4.18-5 [199 kB] Get: 8 http://deb.debian.org/debian bullseye/main arm64 flex arm64 2.6.4-8 [431 kB] Get: 9 http://deb.debian.org/debian bullseye/main arm64 libncurses6 arm64 6.2+20201114-2 [93.2 kB] Get: 10 http://deb.debian.org/debian bullseye/main arm64 libprocps8 arm64 2:3.3.17-5 [61.9 kB] Get: 11 http://deb.debian.org/debian bullseye/main arm64 procps arm64 2:3.3.17-5 [497 kB] Get: 12 http://deb.debian.org/debian bullseye/main arm64 sensible-utils all 0.0.14 [14.8 kB] Get: 13 http://deb.debian.org/debian bullseye/main arm64 libmagic-mgc arm64 1:5.39-3 [273 kB] Get: 14 http://deb.debian.org/debian bullseye/main arm64 libmagic1 arm64 1:5.39-3 [121 kB] Get: 15 http://deb.debian.org/debian bullseye/main arm64 file arm64 1:5.39-3 [69.1 kB] Get: 16 http://deb.debian.org/debian bullseye/main arm64 gettext-base arm64 0.21-4 [173 kB] Get: 17 http://deb.debian.org/debian bullseye/main arm64 autoconf all 2.69-14 [313 kB] Get: 18 http://deb.debian.org/debian bullseye/main arm64 autotools-dev all 20180224.1+nmu1 [77.1 kB] Get: 19 http://deb.debian.org/debian bullseye/main arm64 automake all 1:1.16.3-2 [814 kB] Get: 20 http://deb.debian.org/debian bullseye/main arm64 autopoint all 0.21-4 [510 kB] Get: 21 http://deb.debian.org/debian bullseye/main arm64 bison arm64 2:3.7.5+dfsg-1 [1084 kB] Get: 22 http://deb.debian.org/debian bullseye/main arm64 cmake-data all 3.18.4-2 [1725 kB] Get: 23 http://deb.debian.org/debian bullseye/main arm64 libicu67 arm64 67.1-7 [8467 kB] Get: 24 http://deb.debian.org/debian bullseye/main arm64 libxml2 arm64 2.9.10+dfsg-6.7 [629 kB] Get: 25 http://deb.debian.org/debian bullseye/main arm64 libarchive13 arm64 3.4.3-2+b1 [320 kB] Get: 26 http://deb.debian.org/debian bullseye/main arm64 libbrotli1 arm64 1.0.9-2+b2 [267 kB] Get: 27 http://deb.debian.org/debian bullseye/main arm64 libsasl2-modules-db arm64 2.1.27+dfsg-2.1 [69.3 kB] Get: 28 http://deb.debian.org/debian bullseye/main arm64 libsasl2-2 arm64 2.1.27+dfsg-2.1 [105 kB] Get: 29 http://deb.debian.org/debian bullseye/main arm64 libldap-2.4-2 arm64 2.4.57+dfsg-3 [222 kB] Get: 30 http://deb.debian.org/debian bullseye/main arm64 libnghttp2-14 arm64 1.43.0-1 [73.8 kB] Get: 31 http://deb.debian.org/debian bullseye/main arm64 libpsl5 arm64 0.21.0-1.2 [57.1 kB] Get: 32 http://deb.debian.org/debian bullseye/main arm64 librtmp1 arm64 2.4+20151223.gitfa8646d.1-2+b2 [59.4 kB] Get: 33 http://deb.debian.org/debian bullseye/main arm64 libssh2-1 arm64 1.9.0-2 [150 kB] Get: 34 http://deb.debian.org/debian bullseye/main arm64 libcurl4 arm64 7.74.0-1.3+b1 [321 kB] Get: 35 http://deb.debian.org/debian bullseye/main arm64 libexpat1 arm64 2.2.10-2 [83.1 kB] Get: 36 http://deb.debian.org/debian bullseye/main arm64 libjsoncpp24 arm64 1.9.4-4 [72.5 kB] Get: 37 http://deb.debian.org/debian bullseye/main arm64 librhash0 arm64 1.4.1-2 [127 kB] Get: 38 http://deb.debian.org/debian bullseye/main arm64 libuv1 arm64 1.40.0-1 [126 kB] Get: 39 http://deb.debian.org/debian bullseye/main arm64 cmake arm64 3.18.4-2 [3673 kB] Get: 40 http://deb.debian.org/debian bullseye/main arm64 libdebhelper-perl all 13.3.4 [189 kB] Get: 41 http://deb.debian.org/debian bullseye/main arm64 libtool all 2.4.6-15 [513 kB] Get: 42 http://deb.debian.org/debian bullseye/main arm64 dh-autoreconf all 20 [17.1 kB] Get: 43 http://deb.debian.org/debian bullseye/main arm64 libarchive-zip-perl all 1.68-1 [104 kB] Get: 44 http://deb.debian.org/debian bullseye/main arm64 libsub-override-perl all 0.09-2 [10.2 kB] Get: 45 http://deb.debian.org/debian bullseye/main arm64 libfile-stripnondeterminism-perl all 1.11.0-1 [25.6 kB] Get: 46 http://deb.debian.org/debian bullseye/main arm64 dh-strip-nondeterminism all 1.11.0-1 [15.3 kB] Get: 47 http://deb.debian.org/debian bullseye/main arm64 libelf1 arm64 0.183-1 [164 kB] Get: 48 http://deb.debian.org/debian bullseye/main arm64 dwz arm64 0.13+20210201-1 [155 kB] Get: 49 http://deb.debian.org/debian bullseye/main arm64 gettext arm64 0.21-4 [1261 kB] Get: 50 http://deb.debian.org/debian bullseye/main arm64 intltool-debian all 0.35.0+20060710.5 [26.8 kB] Get: 51 http://deb.debian.org/debian bullseye/main arm64 po-debconf all 1.0.21+nmu1 [248 kB] Get: 52 http://deb.debian.org/debian bullseye/main arm64 debhelper all 13.3.4 [1049 kB] Fetched 27.6 MB in 0s (60.6 MB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package bsdextrautils. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19646 files and directories currently installed.) Preparing to unpack .../00-bsdextrautils_2.36.1-7_arm64.deb ... Unpacking bsdextrautils (2.36.1-7) ... Selecting previously unselected package libuchardet0:arm64. Preparing to unpack .../01-libuchardet0_0.0.7-1_arm64.deb ... Unpacking libuchardet0:arm64 (0.0.7-1) ... Selecting previously unselected package groff-base. Preparing to unpack .../02-groff-base_1.22.4-6_arm64.deb ... Unpacking groff-base (1.22.4-6) ... Selecting previously unselected package libpipeline1:arm64. Preparing to unpack .../03-libpipeline1_1.5.3-1_arm64.deb ... Unpacking libpipeline1:arm64 (1.5.3-1) ... Selecting previously unselected package man-db. Preparing to unpack .../04-man-db_2.9.4-2_arm64.deb ... Unpacking man-db (2.9.4-2) ... Selecting previously unselected package libsigsegv2:arm64. Preparing to unpack .../05-libsigsegv2_2.13-1_arm64.deb ... Unpacking libsigsegv2:arm64 (2.13-1) ... Selecting previously unselected package m4. Preparing to unpack .../06-m4_1.4.18-5_arm64.deb ... Unpacking m4 (1.4.18-5) ... Selecting previously unselected package flex. Preparing to unpack .../07-flex_2.6.4-8_arm64.deb ... Unpacking flex (2.6.4-8) ... Selecting previously unselected package libncurses6:arm64. Preparing to unpack .../08-libncurses6_6.2+20201114-2_arm64.deb ... Unpacking libncurses6:arm64 (6.2+20201114-2) ... Selecting previously unselected package libprocps8:arm64. Preparing to unpack .../09-libprocps8_2%3a3.3.17-5_arm64.deb ... Unpacking libprocps8:arm64 (2:3.3.17-5) ... Selecting previously unselected package procps. Preparing to unpack .../10-procps_2%3a3.3.17-5_arm64.deb ... Unpacking procps (2:3.3.17-5) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../11-sensible-utils_0.0.14_all.deb ... Unpacking sensible-utils (0.0.14) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../12-libmagic-mgc_1%3a5.39-3_arm64.deb ... Unpacking libmagic-mgc (1:5.39-3) ... Selecting previously unselected package libmagic1:arm64. Preparing to unpack .../13-libmagic1_1%3a5.39-3_arm64.deb ... Unpacking libmagic1:arm64 (1:5.39-3) ... Selecting previously unselected package file. Preparing to unpack .../14-file_1%3a5.39-3_arm64.deb ... Unpacking file (1:5.39-3) ... Selecting previously unselected package gettext-base. Preparing to unpack .../15-gettext-base_0.21-4_arm64.deb ... Unpacking gettext-base (0.21-4) ... Selecting previously unselected package autoconf. Preparing to unpack .../16-autoconf_2.69-14_all.deb ... Unpacking autoconf (2.69-14) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../17-autotools-dev_20180224.1+nmu1_all.deb ... Unpacking autotools-dev (20180224.1+nmu1) ... Selecting previously unselected package automake. Preparing to unpack .../18-automake_1%3a1.16.3-2_all.deb ... Unpacking automake (1:1.16.3-2) ... Selecting previously unselected package autopoint. Preparing to unpack .../19-autopoint_0.21-4_all.deb ... Unpacking autopoint (0.21-4) ... Selecting previously unselected package bison. Preparing to unpack .../20-bison_2%3a3.7.5+dfsg-1_arm64.deb ... Unpacking bison (2:3.7.5+dfsg-1) ... Selecting previously unselected package cmake-data. Preparing to unpack .../21-cmake-data_3.18.4-2_all.deb ... Unpacking cmake-data (3.18.4-2) ... Selecting previously unselected package libicu67:arm64. Preparing to unpack .../22-libicu67_67.1-7_arm64.deb ... Unpacking libicu67:arm64 (67.1-7) ... Selecting previously unselected package libxml2:arm64. Preparing to unpack .../23-libxml2_2.9.10+dfsg-6.7_arm64.deb ... Unpacking libxml2:arm64 (2.9.10+dfsg-6.7) ... Selecting previously unselected package libarchive13:arm64. Preparing to unpack .../24-libarchive13_3.4.3-2+b1_arm64.deb ... Unpacking libarchive13:arm64 (3.4.3-2+b1) ... Selecting previously unselected package libbrotli1:arm64. Preparing to unpack .../25-libbrotli1_1.0.9-2+b2_arm64.deb ... Unpacking libbrotli1:arm64 (1.0.9-2+b2) ... Selecting previously unselected package libsasl2-modules-db:arm64. Preparing to unpack .../26-libsasl2-modules-db_2.1.27+dfsg-2.1_arm64.deb ... Unpacking libsasl2-modules-db:arm64 (2.1.27+dfsg-2.1) ... Selecting previously unselected package libsasl2-2:arm64. Preparing to unpack .../27-libsasl2-2_2.1.27+dfsg-2.1_arm64.deb ... Unpacking libsasl2-2:arm64 (2.1.27+dfsg-2.1) ... Selecting previously unselected package libldap-2.4-2:arm64. Preparing to unpack .../28-libldap-2.4-2_2.4.57+dfsg-3_arm64.deb ... Unpacking libldap-2.4-2:arm64 (2.4.57+dfsg-3) ... Selecting previously unselected package libnghttp2-14:arm64. Preparing to unpack .../29-libnghttp2-14_1.43.0-1_arm64.deb ... Unpacking libnghttp2-14:arm64 (1.43.0-1) ... Selecting previously unselected package libpsl5:arm64. Preparing to unpack .../30-libpsl5_0.21.0-1.2_arm64.deb ... Unpacking libpsl5:arm64 (0.21.0-1.2) ... Selecting previously unselected package librtmp1:arm64. Preparing to unpack .../31-librtmp1_2.4+20151223.gitfa8646d.1-2+b2_arm64.deb ... Unpacking librtmp1:arm64 (2.4+20151223.gitfa8646d.1-2+b2) ... Selecting previously unselected package libssh2-1:arm64. Preparing to unpack .../32-libssh2-1_1.9.0-2_arm64.deb ... Unpacking libssh2-1:arm64 (1.9.0-2) ... Selecting previously unselected package libcurl4:arm64. Preparing to unpack .../33-libcurl4_7.74.0-1.3+b1_arm64.deb ... Unpacking libcurl4:arm64 (7.74.0-1.3+b1) ... Selecting previously unselected package libexpat1:arm64. Preparing to unpack .../34-libexpat1_2.2.10-2_arm64.deb ... Unpacking libexpat1:arm64 (2.2.10-2) ... Selecting previously unselected package libjsoncpp24:arm64. Preparing to unpack .../35-libjsoncpp24_1.9.4-4_arm64.deb ... Unpacking libjsoncpp24:arm64 (1.9.4-4) ... Selecting previously unselected package librhash0:arm64. Preparing to unpack .../36-librhash0_1.4.1-2_arm64.deb ... Unpacking librhash0:arm64 (1.4.1-2) ... Selecting previously unselected package libuv1:arm64. Preparing to unpack .../37-libuv1_1.40.0-1_arm64.deb ... Unpacking libuv1:arm64 (1.40.0-1) ... Selecting previously unselected package cmake. Preparing to unpack .../38-cmake_3.18.4-2_arm64.deb ... Unpacking cmake (3.18.4-2) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../39-libdebhelper-perl_13.3.4_all.deb ... Unpacking libdebhelper-perl (13.3.4) ... Selecting previously unselected package libtool. Preparing to unpack .../40-libtool_2.4.6-15_all.deb ... Unpacking libtool (2.4.6-15) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../41-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../42-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libsub-override-perl. Preparing to unpack .../43-libsub-override-perl_0.09-2_all.deb ... Unpacking libsub-override-perl (0.09-2) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../44-libfile-stripnondeterminism-perl_1.11.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.11.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../45-dh-strip-nondeterminism_1.11.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.11.0-1) ... Selecting previously unselected package libelf1:arm64. Preparing to unpack .../46-libelf1_0.183-1_arm64.deb ... Unpacking libelf1:arm64 (0.183-1) ... Selecting previously unselected package dwz. Preparing to unpack .../47-dwz_0.13+20210201-1_arm64.deb ... Unpacking dwz (0.13+20210201-1) ... Selecting previously unselected package gettext. Preparing to unpack .../48-gettext_0.21-4_arm64.deb ... Unpacking gettext (0.21-4) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../49-intltool-debian_0.35.0+20060710.5_all.deb ... Unpacking intltool-debian (0.35.0+20060710.5) ... Selecting previously unselected package po-debconf. Preparing to unpack .../50-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../51-debhelper_13.3.4_all.deb ... Unpacking debhelper (13.3.4) ... Setting up libexpat1:arm64 (2.2.10-2) ... Setting up libpipeline1:arm64 (1.5.3-1) ... Setting up libpsl5:arm64 (0.21.0-1.2) ... Setting up bsdextrautils (2.36.1-7) ... update-alternatives: using /usr/bin/write.ul to provide /usr/bin/write (write) in auto mode Setting up libicu67:arm64 (67.1-7) ... Setting up libmagic-mgc (1:5.39-3) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libdebhelper-perl (13.3.4) ... Setting up libbrotli1:arm64 (1.0.9-2+b2) ... Setting up libnghttp2-14:arm64 (1.43.0-1) ... Setting up libmagic1:arm64 (1:5.39-3) ... Setting up gettext-base (0.21-4) ... Setting up file (1:5.39-3) ... Setting up libsasl2-modules-db:arm64 (2.1.27+dfsg-2.1) ... Setting up autotools-dev (20180224.1+nmu1) ... Setting up libuv1:arm64 (1.40.0-1) ... Setting up librtmp1:arm64 (2.4+20151223.gitfa8646d.1-2+b2) ... Setting up libncurses6:arm64 (6.2+20201114-2) ... Setting up libsigsegv2:arm64 (2.13-1) ... Setting up autopoint (0.21-4) ... Setting up libsasl2-2:arm64 (2.1.27+dfsg-2.1) ... Setting up libjsoncpp24:arm64 (1.9.4-4) ... Setting up sensible-utils (0.0.14) ... Setting up librhash0:arm64 (1.4.1-2) ... Setting up libuchardet0:arm64 (0.0.7-1) ... Setting up libsub-override-perl (0.09-2) ... Setting up libssh2-1:arm64 (1.9.0-2) ... Setting up cmake-data (3.18.4-2) ... Setting up libelf1:arm64 (0.183-1) ... Setting up libxml2:arm64 (2.9.10+dfsg-6.7) ... Setting up libprocps8:arm64 (2:3.3.17-5) ... Setting up libfile-stripnondeterminism-perl (1.11.0-1) ... Setting up gettext (0.21-4) ... Setting up libtool (2.4.6-15) ... Setting up libarchive13:arm64 (3.4.3-2+b1) ... Setting up libldap-2.4-2:arm64 (2.4.57+dfsg-3) ... Setting up m4 (1.4.18-5) ... Setting up intltool-debian (0.35.0+20060710.5) ... Setting up autoconf (2.69-14) ... Setting up dh-strip-nondeterminism (1.11.0-1) ... Setting up dwz (0.13+20210201-1) ... Setting up groff-base (1.22.4-6) ... Setting up procps (2:3.3.17-5) ... Setting up bison (2:3.7.5+dfsg-1) ... update-alternatives: using /usr/bin/bison.yacc to provide /usr/bin/yacc (yacc) in auto mode Setting up libcurl4:arm64 (7.74.0-1.3+b1) ... Setting up automake (1:1.16.3-2) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up flex (2.6.4-8) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up man-db (2.9.4-2) ... Not building database; man-db/auto-update is not 'true'. Setting up dh-autoreconf (20) ... Setting up cmake (3.18.4-2) ... Setting up debhelper (13.3.4) ... Processing triggers for libc-bin (2.31-12) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps I: Building the package I: Running cd /build/dawg-1.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../dawg_1.2-3_source.changes dpkg-buildpackage: info: source package dawg dpkg-buildpackage: info: source version 1.2-3 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Andreas Tille dpkg-source --before-build . dpkg-buildpackage: info: host architecture arm64 debian/rules clean dh clean dh_clean debian/rules binary dh binary dh_update_autotools_config dh_autoreconf debian/rules override_dh_auto_configure make[1]: Entering directory '/build/dawg-1.2' dh_auto_configure -- \ -DCMAKE_LIBRARY_PATH=aarch64-linux-gnu \ -DCMAKE_DATA_DIR=/usr/share/doc/dawg cd obj-aarch64-linux-gnu && cmake -DCMAKE_INSTALL_PREFIX=/usr -DCMAKE_BUILD_TYPE=None -DCMAKE_INSTALL_SYSCONFDIR=/etc -DCMAKE_INSTALL_LOCALSTATEDIR=/var -DCMAKE_EXPORT_NO_PACKAGE_REGISTRY=ON -DCMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY=ON -DCMAKE_INSTALL_RUNSTATEDIR=/run -DCMAKE_SKIP_INSTALL_ALL_DEPENDENCY=ON "-GUnix Makefiles" -DCMAKE_VERBOSE_MAKEFILE=ON -DCMAKE_INSTALL_LIBDIR=lib/aarch64-linux-gnu -DCMAKE_LIBRARY_PATH=aarch64-linux-gnu -DCMAKE_DATA_DIR=/usr/share/doc/dawg .. -- The C compiler identification is GNU 10.2.1 -- The CXX compiler identification is GNU 10.2.1 -- Detecting C compiler ABI info -- Detecting C compiler ABI info - done -- Check for working C compiler: /usr/bin/cc - skipped -- Detecting C compile features -- Detecting C compile features - done -- Detecting CXX compiler ABI info -- Detecting CXX compiler ABI info - done -- Check for working CXX compiler: /usr/bin/c++ - skipped -- Detecting CXX compile features -- Detecting CXX compile features - done -- Looking for bison -- Looking for bison -- /usr/bin/bison -- Looking for flex -- Looking for flex -- /usr/bin/flex -- Looking for unistd.h -- Looking for unistd.h - found -- Looking for process.h -- Looking for process.h - not found -- Looking for io.h -- Looking for io.h - not found -- Looking for getopt.h -- Looking for getopt.h - found -- Looking for stdint.h -- Looking for stdint.h - found -- Looking for sys/types.h -- Looking for sys/types.h - found -- Looking for getpid -- Looking for getpid - found -- Looking for _getpid -- Looking for _getpid - not found -- Looking for copysign -- Looking for copysign - found -- Looking for _copysign -- Looking for _copysign - not found -- Looking for snprintf -- Looking for snprintf - found -- Looking for _snprintf -- Looking for _snprintf - not found -- Configuring done -- Generating done CMake Warning: Manually-specified variables were not used by the project: CMAKE_EXPORT_NO_PACKAGE_REGISTRY CMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY CMAKE_INSTALL_LIBDIR CMAKE_INSTALL_LOCALSTATEDIR CMAKE_INSTALL_RUNSTATEDIR CMAKE_INSTALL_SYSCONFDIR CMAKE_LIBRARY_PATH -- Build files have been written to: /build/dawg-1.2/obj-aarch64-linux-gnu make[1]: Leaving directory '/build/dawg-1.2' dh_auto_build cd obj-aarch64-linux-gnu && make -j8 "INSTALL=install --strip-program=true" VERBOSE=1 make[1]: Entering directory '/build/dawg-1.2/obj-aarch64-linux-gnu' /usr/bin/cmake -S/build/dawg-1.2 -B/build/dawg-1.2/obj-aarch64-linux-gnu --check-build-system CMakeFiles/Makefile.cmake 0 /usr/bin/cmake -E cmake_progress_start /build/dawg-1.2/obj-aarch64-linux-gnu/CMakeFiles /build/dawg-1.2/obj-aarch64-linux-gnu//CMakeFiles/progress.marks make -f CMakeFiles/Makefile2 all make[2]: Entering directory '/build/dawg-1.2/obj-aarch64-linux-gnu' make -f src/CMakeFiles/dawg.dir/build.make src/CMakeFiles/dawg.dir/depend make[3]: Entering directory '/build/dawg-1.2/obj-aarch64-linux-gnu' [ 15%] Generating parser.tab.cpp, parser.tab.hpp [ 15%] Generating lex.parser.cpp cd /build/dawg-1.2/obj-aarch64-linux-gnu/src && /usr/bin/bison --name-prefix=parser --defines --output-file=/build/dawg-1.2/obj-aarch64-linux-gnu/src/parser.tab.cpp /build/dawg-1.2/src/parser.ypp cd /build/dawg-1.2/obj-aarch64-linux-gnu/src && /usr/bin/flex -Pparser -o/build/dawg-1.2/obj-aarch64-linux-gnu/src/lex.parser.cpp /build/dawg-1.2/src/parser.lpp cd /build/dawg-1.2/obj-aarch64-linux-gnu && /usr/bin/cmake -E cmake_depends "Unix Makefiles" /build/dawg-1.2 /build/dawg-1.2/src /build/dawg-1.2/obj-aarch64-linux-gnu /build/dawg-1.2/obj-aarch64-linux-gnu/src /build/dawg-1.2/obj-aarch64-linux-gnu/src/CMakeFiles/dawg.dir/DependInfo.cmake --color= Dependee "/build/dawg-1.2/obj-aarch64-linux-gnu/src/CMakeFiles/dawg.dir/DependInfo.cmake" is newer than depender "/build/dawg-1.2/obj-aarch64-linux-gnu/src/CMakeFiles/dawg.dir/depend.internal". Dependee "/build/dawg-1.2/obj-aarch64-linux-gnu/src/CMakeFiles/CMakeDirectoryInformation.cmake" is newer than depender "/build/dawg-1.2/obj-aarch64-linux-gnu/src/CMakeFiles/dawg.dir/depend.internal". Scanning dependencies of target dawg make[3]: Leaving directory '/build/dawg-1.2/obj-aarch64-linux-gnu' make -f src/CMakeFiles/dawg.dir/build.make src/CMakeFiles/dawg.dir/build make[3]: Entering directory '/build/dawg-1.2/obj-aarch64-linux-gnu' [ 30%] Building CXX object src/CMakeFiles/dawg.dir/eigen.cpp.o [ 30%] Building CXX object src/CMakeFiles/dawg.dir/indel.cpp.o [ 38%] Building CXX object src/CMakeFiles/dawg.dir/matrix.cpp.o cd /build/dawg-1.2/obj-aarch64-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-aarch64-linux-gnu/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/eigen.cpp.o -c /build/dawg-1.2/src/eigen.cpp [ 46%] Building CXX object src/CMakeFiles/dawg.dir/dawg.cpp.o cd /build/dawg-1.2/obj-aarch64-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-aarch64-linux-gnu/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/indel.cpp.o -c /build/dawg-1.2/src/indel.cpp [ 53%] Building CXX object src/CMakeFiles/dawg.dir/output.cpp.o [ 61%] Building CXX object src/CMakeFiles/dawg.dir/rand.cpp.o cd /build/dawg-1.2/obj-aarch64-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-aarch64-linux-gnu/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/dawg.cpp.o -c /build/dawg-1.2/src/dawg.cpp cd /build/dawg-1.2/obj-aarch64-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-aarch64-linux-gnu/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/matrix.cpp.o -c /build/dawg-1.2/src/matrix.cpp [ 69%] Building CXX object src/CMakeFiles/dawg.dir/tree.cpp.o [ 76%] Building CXX object src/CMakeFiles/dawg.dir/var.cpp.o cd /build/dawg-1.2/obj-aarch64-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-aarch64-linux-gnu/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/output.cpp.o -c /build/dawg-1.2/src/output.cpp cd /build/dawg-1.2/obj-aarch64-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-aarch64-linux-gnu/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/rand.cpp.o -c /build/dawg-1.2/src/rand.cpp cd /build/dawg-1.2/obj-aarch64-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-aarch64-linux-gnu/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/tree.cpp.o -c /build/dawg-1.2/src/tree.cpp cd /build/dawg-1.2/obj-aarch64-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-aarch64-linux-gnu/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/var.cpp.o -c /build/dawg-1.2/src/var.cpp [ 84%] Building CXX object src/CMakeFiles/dawg.dir/lex.parser.cpp.o cd /build/dawg-1.2/obj-aarch64-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-aarch64-linux-gnu/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -I "/build/dawg-1.2/src" -o CMakeFiles/dawg.dir/lex.parser.cpp.o -c /build/dawg-1.2/obj-aarch64-linux-gnu/src/lex.parser.cpp In file included from /build/dawg-1.2/src/dawg.cpp:20: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/dawg.cpp:20: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.cpp:4: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/tree.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.cpp:4: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/tree.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/dawg.cpp:20: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/dawg.cpp:20: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.cpp:4: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/tree.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.cpp:4: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/tree.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/var.cpp:4: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/var.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/var.cpp:4: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/var.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/var.cpp:4: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/var.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/var.cpp:4: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/var.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/output.cpp:4: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/output.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/output.cpp:4: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/output.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.lpp:5: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/output.cpp:4: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.lpp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/output.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/output.cpp:4: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/output.cpp:3: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.lpp:5: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.lpp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.lpp:5: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.lpp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.lpp:5: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.lpp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ [ 92%] Building CXX object src/CMakeFiles/dawg.dir/parser.tab.cpp.o cd /build/dawg-1.2/obj-aarch64-linux-gnu/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-aarch64-linux-gnu/src -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -I "/build/dawg-1.2/src" -o CMakeFiles/dawg.dir/parser.tab.cpp.o -c /build/dawg-1.2/obj-aarch64-linux-gnu/src/parser.tab.cpp In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.ypp:5: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 17 | std::auto_ptr m_pSib; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.ypp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.ypp:5: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 18 | std::auto_ptr m_pSub; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.ypp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.ypp:5: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 199 | std::auto_ptr m_pInsertionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.ypp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.ypp:5: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] 200 | std::auto_ptr m_pDeletionModel; | ^~~~~~~~ In file included from /usr/include/c++/10/bits/locale_conv.h:41, from /usr/include/c++/10/locale:43, from /usr/include/c++/10/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.ypp:4: /usr/include/c++/10/bits/unique_ptr.h:57:28: note: declared here 57 | template class auto_ptr; | ^~~~~~~~ [100%] Linking CXX executable dawg cd /build/dawg-1.2/obj-aarch64-linux-gnu/src && /usr/bin/cmake -E cmake_link_script CMakeFiles/dawg.dir/link.txt --verbose=1 /usr/bin/c++ -g -O2 -fdebug-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -Wl,-z,relro -Wl,-z,now -rdynamic CMakeFiles/dawg.dir/dawg.cpp.o CMakeFiles/dawg.dir/eigen.cpp.o CMakeFiles/dawg.dir/indel.cpp.o CMakeFiles/dawg.dir/matrix.cpp.o CMakeFiles/dawg.dir/output.cpp.o CMakeFiles/dawg.dir/rand.cpp.o CMakeFiles/dawg.dir/tree.cpp.o CMakeFiles/dawg.dir/var.cpp.o CMakeFiles/dawg.dir/lex.parser.cpp.o CMakeFiles/dawg.dir/parser.tab.cpp.o -o dawg make[3]: Leaving directory '/build/dawg-1.2/obj-aarch64-linux-gnu' [100%] Built target dawg make[2]: Leaving directory '/build/dawg-1.2/obj-aarch64-linux-gnu' /usr/bin/cmake -E cmake_progress_start /build/dawg-1.2/obj-aarch64-linux-gnu/CMakeFiles 0 make[1]: Leaving directory '/build/dawg-1.2/obj-aarch64-linux-gnu' debian/rules override_dh_auto_test make[1]: Entering directory '/build/dawg-1.2' # FIXME: This test fails - but let the build pass anyway for the moment cd tests && PATH=$PATH:/build/dawg-1.2/obj-aarch64-linux-gnu/src sh test0.sh || true 2,3c2,3 < TCCTTGACCAGTTAGCAAGACGATATGCATCAAGTGCACTGGC---GTAAGTCTTTTTAC < GCTGATCATA--TAGTCCGTATAGTCACTGAACGCCGTCCTCTCG --- > AGGAACTGGTCACGTTCTGCTATACGTAGTTCACGTGACCGCATTCAGAAAAATGCGACT > AGTATTGTGATCAGGCATATCAGTGACTTGCGGCAGGAGAGC 6,7c6,7 < TCGTTGGACAGT--GCAAGACGCTATGCATCAAGTGCACTGGCTAGGTAAGTGCGTTTAT < GATGAGCACAACAGGTCCGGATAGTCCCTGAACGCTATACTCCCG --- > AGCAACTTGTCACGTTCTGCGATACGTAGTTCACGTGACCGCATTCACGCAAACACTACT > TGTGCT--GACCATGCATATCAGGGACTTGCGACATGTGGGC 10,11c10,11 < TCGA-CCCCAAA--TTAATACGTTAGTCATCAAGTGCACTGAC---GTAATAGCGTTTAT < GATGATGAGTACTAGCCCGTGGAAACCCTAAAAGCGTTACCCCCG --- > AGCATGGTGTCAAGTTCTGCGTTCAGTAGTTAACCAGACGGCATTAACGCTAATACATC- > -GTGTT--GACCTACCAACGTACGGACTTGCGTAATGTGGTC 14,15c14,15 < TCGTTGAACAGT--GCAAGACGCTATGCATCAAGTGCACTGGC---GTAAGTGCGTTTAT < GATGAACACAACTGGTCCGTATAGTCCCTGAACGCTGTACTCCCG --- > AGCAACTTGTCACGTTCTGCGATACGTAGTTCACGTGACCGCATTCACGCAAATACTACT > TGTGTT--GACCAGGCATATCAGGGACTTGCGACATGAGGGC 18,19c18,19 < TCGTACCACAGT--TCAAGACGCTAGGCATCAAGTGCACTGGC---GTAATTGCGTTTAT < GATGGACACAACTAGTCCGTTGAATCCCTGAACGCTTTACCCCCG --- > AGCATGGTGTCAAGTTCTGCGATCCGTAGTTCACGTGACCGCATTAACGCAAATACTACC > TGTGTT--GATCAGGCAACTTAGGGACTTGCGAAATGGGGGC make[1]: Leaving directory '/build/dawg-1.2' create-stamp debian/debhelper-build-stamp dh_prep dh_auto_install cd obj-aarch64-linux-gnu && make -j8 install DESTDIR=/build/dawg-1.2/debian/dawg AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/dawg-1.2/obj-aarch64-linux-gnu' /usr/bin/cmake -S/build/dawg-1.2 -B/build/dawg-1.2/obj-aarch64-linux-gnu --check-build-system CMakeFiles/Makefile.cmake 0 make -f CMakeFiles/Makefile2 preinstall make[2]: Entering directory '/build/dawg-1.2/obj-aarch64-linux-gnu' make[2]: Nothing to be done for 'preinstall'. make[2]: Leaving directory '/build/dawg-1.2/obj-aarch64-linux-gnu' Install the project... /usr/bin/cmake -P cmake_install.cmake -- Install configuration: "None" -- Installing: /build/dawg-1.2/debian/dawg/usr/bin/dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/applications/dawg.desktop -- Installing: /build/dawg-1.2/debian/dawg/usr/share/pixmaps/dawg.png -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example0.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example1.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example2.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example3.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example4.dawg make[1]: Leaving directory '/build/dawg-1.2/obj-aarch64-linux-gnu' dh_install dh_installdocs dh_installchangelogs dh_installman dh_perl dh_link dh_strip_nondeterminism dh_compress debian/rules override_dh_fixperms make[1]: Entering directory '/build/dawg-1.2' dh_fixperms chmod -x debian/dawg/usr/share/doc/dawg/examples/* make[1]: Leaving directory '/build/dawg-1.2' dh_missing dh_dwz -a dh_strip -a dh_makeshlibs -a dh_shlibdeps -a dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'dawg-dbgsym' in '../dawg-dbgsym_1.2-3_arm64.deb'. dpkg-deb: building package 'dawg' in '../dawg_1.2-3_arm64.deb'. dpkg-genbuildinfo --build=binary dpkg-genchanges --build=binary >../dawg_1.2-3_arm64.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/25778 and its subdirectories I: Current time: Wed Jul 7 10:35:24 -12 2021 I: pbuilder-time-stamp: 1625697324 Wed Jul 7 22:35:25 UTC 2021 I: 1st build successful. Starting 2nd build on remote node codethink9-arm64.debian.net. Wed Jul 7 22:35:25 UTC 2021 I: Preparing to do remote build '2' on codethink9-arm64.debian.net. Wed Jul 7 22:36:24 UTC 2021 I: Deleting $TMPDIR on codethink9-arm64.debian.net. Wed Jul 7 22:36:25 UTC 2021 I: dawg_1.2-3_arm64.changes: Format: 1.8 Date: Mon, 16 Nov 2020 10:20:01 +0100 Source: dawg Binary: dawg dawg-dbgsym Architecture: arm64 Version: 1.2-3 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team Changed-By: Andreas Tille Description: dawg - simulate the evolution of recombinant DNA sequences Changes: dawg (1.2-3) unstable; urgency=medium . * Team upload. * Standards-Version: 4.5.0 (routine-update) * debhelper-compat 13 (routine-update) * Respect DEB_BUILD_OPTIONS in override_dh_auto_test target (routine- update) * autopkgtest: s/ADTTMP/AUTOPKGTEST_TMP/g (routine-update) * Add salsa-ci file (routine-update) * Rules-Requires-Root: no (routine-update) * Set upstream metadata fields: Bug-Database, Bug-Submit, Repository, Repository-Browse. Checksums-Sha1: 05af56d0ac54c13d4e575cfc74ce2a393cf290aa 746332 dawg-dbgsym_1.2-3_arm64.deb 17ff17aed5fdce230512c53cc48f7aa7c0bea8da 5580 dawg_1.2-3_arm64.buildinfo ee8165c9618a3b2b411619d94463a29fe1097fae 70380 dawg_1.2-3_arm64.deb Checksums-Sha256: d2ec76cb6eb643bcc50304b166cde4ea6cfff8d45b5eeecae189e4d40febac3c 746332 dawg-dbgsym_1.2-3_arm64.deb 28f822fcba77def2d28b41d28f1807c306c9abd1e31cb5e3fe3ad4d73711e830 5580 dawg_1.2-3_arm64.buildinfo d397a8f8e4e97bd4996b2a589a2f358c6c6afb419842ed68abf325290bf55d8f 70380 dawg_1.2-3_arm64.deb Files: 0c63f5ada060f7a336cf729cc17e3222 746332 debug optional dawg-dbgsym_1.2-3_arm64.deb f8d6d7ee038b2c0dc36d8c769cc43b64 5580 science optional dawg_1.2-3_arm64.buildinfo 62f6e9a159e27b9eddd992c1413a42ab 70380 science optional dawg_1.2-3_arm64.deb Wed Jul 7 22:36:26 UTC 2021 I: diffoscope 177 will be used to compare the two builds: # Profiling output for: /usr/bin/diffoscope --html /srv/reproducible-results/rbuild-debian/tmp.ztGLzrhpun/dawg_1.2-3.diffoscope.html --text /srv/reproducible-results/rbuild-debian/tmp.ztGLzrhpun/dawg_1.2-3.diffoscope.txt --json /srv/reproducible-results/rbuild-debian/tmp.ztGLzrhpun/dawg_1.2-3.diffoscope.json --profile=- /srv/reproducible-results/rbuild-debian/tmp.ztGLzrhpun/b1/dawg_1.2-3_arm64.changes /srv/reproducible-results/rbuild-debian/tmp.ztGLzrhpun/b2/dawg_1.2-3_arm64.changes ## command (total time: 0.000s) 0.000s 1 call cmp (internal) ## has_same_content_as (total time: 0.000s) 0.000s 1 call abc.DotChangesFile ## main (total time: 0.299s) 0.299s 2 calls outputs 0.000s 1 call cleanup ## recognizes (total time: 0.034s) 0.034s 10 calls diffoscope.comparators.binary.FilesystemFile 0.000s 8 calls abc.DotChangesFile Wed Jul 7 22:36:28 UTC 2021 I: diffoscope 177 found no differences in the changes files, and a .buildinfo file also exists. Wed Jul 7 22:36:28 UTC 2021 I: dawg from bullseye built successfully and reproducibly on arm64. Wed Jul 7 22:36:31 UTC 2021 I: Submitting .buildinfo files to external archives: Wed Jul 7 22:36:31 UTC 2021 I: Submitting 8.0K b1/dawg_1.2-3_arm64.buildinfo.asc Wed Jul 7 22:36:31 UTC 2021 I: Submitting 8.0K b2/dawg_1.2-3_arm64.buildinfo.asc Wed Jul 7 22:36:32 UTC 2021 I: Done submitting .buildinfo files to http://buildinfo.debian.net/api/submit. Wed Jul 7 22:36:32 UTC 2021 I: Done submitting .buildinfo files. Wed Jul 7 22:36:32 UTC 2021 I: Removing signed dawg_1.2-3_arm64.buildinfo.asc files: removed './b1/dawg_1.2-3_arm64.buildinfo.asc' removed './b2/dawg_1.2-3_arm64.buildinfo.asc'